Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
MIP-300 Final
| Question | Answer |
|---|---|
| A non-retrovirus positive sense RNA viruses will require reverse transcriptase and integrase to replicate | False |
| A non-retrovirus positive sense RNA viruses will require cellular RNA polymerase to replicate | False |
| Negative sense RNA viruses will require Integrase to replicate | False |
| Negative sense RNA viruses will require cellular DNA polymerase to replicate | False |
| DNA viruses will require replicase activity to replicate | False |
| DNA viruses will require reverse transcriptase to replicate | False |
| A retrovirus will require reverse transcriptase and integrase to replicate | True |
| A retrovirus will require both transcriptase and replicase activity to replicate | False |
| In a positive sense RNA retrovirus, what step follows production of viral proteins? | Packaging of viral genomes into capsids |
| In a negative sense RNA virus, what step follows production of viral proteins? | Production of viral replicative form |
| who provides the lipids in a viral envelope | the cell |
| all viruses have a protein coat | True |
| a virulent phage can inadvertently package host cell chromosome into phage particles | True |
| you have a bacterium that picks up a new gene by Hfr conjugation. what is an explanation of why progeny of this bacterium express this trait? | the gene is integrated into the genome |
| after successful transformation of a fragment of chromosomal DNA, the recipient (female) will become a donor (male) capable of creating a sex pili to transfer DNA | False |
| you isolate a virulent page. It can perform specialized transduction | False |
| you want to know if a baby still has vaccine neutralizing antibody that it received from its mom in utero. Which of the following types of ELISAs would you run? one that tests for | IgG |
| in differential centrifugation, virus is first centrifuged at a slow speed, the supernatant is removed and re-centrifuged at a very fast speed | True |
| Virus stocks prepared by differential centrifugation and gradient centrifugation are equally clean | False |
| hemagglutination assay | determines highest dilution of virus that causes red blood cells to clump together |
| cytopathic effect | a visible effect on a host cell, caused by a virus, that may result in host cell damage or death |
| plaque assay | method used to measure the number of viral particles present in a sample |
| a temperate phage can inadvertently package host cell chromosome into phage particles | True |
| you isolate a bacterium that can transfer genes to other bacteria only when it is in direct contact with these bacteria. it is most likely transferring the genes by | conjugation |
| a piece of host cell dna bound to a piece of phage dna after excising from the chromosome. when this phage that contains host cell dna infects a new cell, will the new cell be killed by this infection? | No |
| after successful generalized transduction, the recipient (female) will become a donor (male) capable of creating a sex pili to transfer dna | False |
| can a temperate phage perform generalized and specialized transduction? | yes |
| what kind of organism can carry out the conversion of O2 --> H2O? | aerobic respiration and aerobic chemolithotrophy |
| an error in dna replication causes a mutation changing AGG to CGG, what change do you expect? | no change to protein function |
| the organism with the more positive reduction potential will produce more energy | true |
| dna ligase forms | the last phosphodiester bond between dna single strands |
| dna ligase forms hydrogen bonds | False |
| for each acetyl-coA that enters the TCA cycle, how many ATP are generayed by substrate level phosphorylation | 1 |
| you correctly perform a gram stain on bacteria that contain LPS, what color will you see on the slide? | Pink |
| a bacterium contains 2 carbohydrates and 5 different amino acids in its cell wall. What color will it gram stain? | Purple |
| an antibiotic inhibits ribosome function and prevents bacteria from sporulating. which step in sporulation is affected | formation of spore coats |
| a bacterium is known to be a psychophile. which of the following would be true for this organism? | generation time shortest at 0-20 degrees celcsius and growth rate the fastest |
| you grow a bacteria in a tube that is loosely capped. it grows evenly throughout the tube. the bacteria is likely | aerotolerant anaerobe |
| a bacterium has recently acquired antibiotic resistance, which of the following could NOT be a way this occurred | someone stopped taking her antibiotics early |
| what is the most effective type of vaccine? will you have full immunity if you get the vaccine 5 days before exposure | attenuated; no |
| you have abdominal pain, headache and a bacterial blood infection. are these signs or symptoms? what type of antibody? | symptoms and IgG |
| you isolate a new canine virus that is similiar to a virus previously seen in birds. what type of change has occured? | antigenic shift |
| newborns get some protections from their mothers. what is protecting them? where is the protection coming from? | IgA and igG and breast milk and placenta |
| how many different B cells will be specific for a bacterium with a protein with 4 binding sites and a protein with 3 | 7, one B cell for each epitope |
| you go to the ER for a severe drop in blood pressure. which of the following might be responsible? how will it stain? | endotoxin or superantigen, pink or purple |
| a patient has a B cell mutation that prevents antibody production. Which can they still do at normal levels? | activate CTLs specific for the virus |
| you start having diarrhea 4 hours after eating at a sketchy taco shop. This is likely a | food intoxication |
| to ensure a gene inserted in a plasmid is in the correct orientation you should use | 2 different sticky ends |
| prions cause disease by | converting normal proteins to abnormal proteins |
| an antiviral that inactivates transcriptase activity will be effective against a + sense RNA virus | False |
| for a negative sense RNA virus, protein translation will start before replicase acts | True |
| you mix dead S strain with a live R strain of bacteria that is not competent. Will the mouse live or die? | The mouse will live |
| a bacteria took up pUC19 that did not contain the gene of interest. what will be on your plate with ampicillin | the colonies will be blue |
| a patient is in shock and exhibiting extremely low blood pressure. assuming your patient is suffering from a bacterial infection, which of the following could be causing the shock symptoms | either endotoxin or exotoxin |
| a patient can do these at normal levels: neutralize a parasitic worm, phagoctize microbes and fix complement. However the patient cannot activate CTLs at a normal level. What part of the immune system does this patient most likely have deficiency in? | class I MHC |
| people with HIV have no functional CD4+ T cells. what would you expect the immune system in these individuals to no longer be able to do? | activate macrophages to be more hostile -generate plasma cells and memory B cells through clonal selection -generate CTLs through clonal selection to kill virus infected cells and tumor cells |
| mRNA sequence of: "5'UCAUUCGCCCGAAACCAAAUGAG" DNA template will be | 3' AGTAAGCGGGCTTT..." |
| how would you classify the primase enzyme | DNA dependent RNA polymerase |
| how many acetly coA and FADH2 will be produced from a 100-carbon fatty acid BEFORE the fatty acid feeds into aerobic respiration | 50,49 |
| a bacterium eats an amino acid that once the nitrogen is removed contains 3 carbon atoms. where in anaerobic respiration could this amino acid feed into the pathway to be digested? | as pyruvate |
| when acetly coA enters the TCA cycle, how many NADH are produced for the oxidation of 1 acetyl coA molecule? | 3 |
| ATP is generated from which of the following steps during the fermentation of sugar | Glycolysis |
| for the mRNA, what is the anti-codon for the tRNA carrying the 3rd amino acid incorporated in the protein (before post-translational modifications)? 5' AUGCUAGCAUCU 3' | 3' CGU 5' |
| you isolate a bacterium that has a mutation in the RNA polymerase gene such that enzyme can no longer bind to the promoter region. what is most likely to occur | ecreased transcription of mRNA |
| you discover a bacterium that subsists solely from oxidizing donuts and reducing iron. During the TCA cycle, how many substrate-level phosphorylations will this organism produce from 1 glucose molecule? | 2 ATP/GTP |
| what are the affects of frameshift mutation? | could affect all amino acids downstream from the addition or deletion - changes the reading frame so that an entirely different set of codons is used - may result in a protein that is truncated and possibly non-functional |
| one molecule of G3P feeds into aerobic respiration while your pet bacterium is enjoying a snack. How many ATP/GTP will be generated by oxidative phosprylation? | 17 |
| you isolate a photosynthetic bacterium that has a mutation in the photosynthetic electron transport chain which causes it to stop functioning. indicate which of the following would NOT be affected by this mutation | oxidation of water |
| you isolate an organism that degrades bisphenol plastic found in the great pacific garbage patch. you find that in the process it converts Fe3+ to Fe2+ what types of metabolism can this organism be performing? | anaerobic respiration |
| what types of metabolism can carry out the reaction NO2 to NH4+? | anaerobic respiration and anaerobic chemolithotrophy |
| you have isolated a cell that possesses a double stranded dna, 70s ribosomes, a plasma membrane composed of a phospholipid bilayer. Into which domain would you classify this as? | eukarya, bacteria, archaea |
| what organisms could cause stomach infections in dogs? | mesophilic, acidophilic |
| virulent phage can enter lysogeny | False |
| virulent phage can carry out lytic cycle | True |
| generalized transduction occurs when phage undergoes improper excision | False |
| how many translocations will occur for a protein that contains 22 amino acids | 21 |
| you are studying an organism that oxidizes glucose using anaerobic respiration. the electron donor is organic | True |
| pyrvuate or derivative is oxidized during fermentation | False |
| during the dark reaction of photolithotrophy, organic material is produced | True |
| during the light reaction of photolithotrophy, the initial electron donor is oxygen | False |
| during the dark reaction of photolithotrophy, organic material is consumed | False |
| an organism that oxidizes Fe2+ for energy belongs to | chemolithoautotrophs |
| pathway for aerobic respiration will an organism use in order to oxidize a 16 carbon fatty acid | glycolysis, beta-oxidation, intermediate step, tca cycle, etc |
| how many atps will be generated at the etc from 1 FADH2 for a bacterium that oxidizes glucose using aerobic respiration | 2 ATP |
| a bacterium oxidizes glucose using anaerobic respiration. how many atps will be generated at the etc from 1 NADH | <3 ATP |
| five NADH molecules will be generated from the beta-oxidation of a 12 carbon fatty acid | True |
| some activated B cells differentiate into memory b cells rather than plasma cells | True |
| each b cell is specific for one, unique epitope | True |
| each antibody is composed of two heavy chains and two light chains | True |
| each antibody has a unique variable region that binds to an antigen on an epitope | False |
| IgA is located at mucosal surfaces | true |
| neutralization is when antibody binds to a virus before the virus can bind to a host cell receptor | True |
| if an antigen has 3 different eptiopes, how many different B cells will bind to this antigen | 3 |
| endotoxin most frequently causes | decreased blood pressure and shock |
| neurotoxins are a type of | exotoxin |
| exotoxin | a protein that is excreted from inside a bacterial cell to the environment |
| injection with a gamma globulin shots will result in the production of memory T cells | False |
| during the asymptomatic phase of HIV infection | people are still infectious, peoples immune systems are being slowly killed by the virus, people will often have a flu like syndrome |
| during a primary immune response you will find activated CTL cells in | 7-10 days |
| you inject a baby with a plasmid that contains the genes for the production of pili protein. this is an example of a ______ vaccine | recombinant DNA |
| in eukaryotic cells, the function of ribosomes is | protein production |
| both gram positive and gram negative organisms have NAG and NAM | True |
| all micro organisms have ribosomes | False |
Created by:
sdturner
Popular Bacteriology sets