Save
Busy. Please wait.
Log in with Clever
or
show password
Forgot Password?
Don't have an account?  Sign up 
Sign up using Clever
or
Username is available taken
show password


Make sure to remember your password. If you forget it there is no way for StudyStack to send you a reset link. You would need to create a new account. Your email address is only used to allow you to reset your password. See our Privacy Policy and Terms of Service.

Already a StudyStack user? Log In

Reset Password
Enter the associated with your account, and we'll email you a link to reset your password.
focusNode
Didn't know it?
click below
 
Knew it?
click below
Don't Know
Remaining cards (0)
Know
0:00
edit
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.

  Normal Size     Small Size show me how

MIP-300 exam 3

QuestionAnswer
In respiration, the initial electron donor is organic. True
You are studying an organism that oxidizes glucose using anaerobic respiration. The electron donor is organic. True
During fermentation, most of the ATP generated are created by oxidative phosphorylation during the ETC. False
In fermentation, the final electron acceptor is inorganic. False
In chemolithotrophy the initial electron donor can be... Inorganic
Which of the following is true of anaerobic chemolithotrophy? The final electron acceptor is an inorganic molecule other than oxygen & the ETC occurs
During the dark reaction of photolithotrophy, organic material is produced. True
During the dark reaction of photolithotrophy, NADPH accepts electrons. False
A microbe that gains energy by oxidizing fatty acids uses chemolithotrophy as its metabolism. False
You isolate an organism that gains energy by oxidizing Fe2+ as an initial electron donor in the absence of sunlight. Which of the following metabolisms could it be using? Chemolithotrophy
NADH -->NAD is an ___________ reaction Oxidation
A chemolithotrophic autotroph usually performs the TCA cycle False
Fermentation does not use an electron transport chain because there is no NAD to accept the electrons from the electron transport chain. False
2 orgs use of FADH2 (E0 = -0.18) as electron donor. Org. A uses ubiquinone (E0 = 0.10) as electron acceptor and organism B uses Fe3+ (E0 = 0.771).Org. B will produce more energy per electron donated to the electron transport chain than organism A. False
During the light reactions NADPH feeds electrons into the electron transport chain to create the ATP that will be used to fix CO2. False
In the reaction Fe3+ --> Fe2+; Fe3+ is serving as an electron___________ Acceptor
Which of the pathways will be used during aerobic respiration? Glycolysis, TCA cycle, & Electron transport chain
Which of the pathways will be used during anaerobic respiration? Glycolysis, TCA cycle, & Electron transport chain
S--> H2S is an ___________ reaction Reduction
Pyruvate or a derivative of pyruvate are reduced when they accept electrons from the electron transport chain when oxygen levels are low. False
a chemoorganotrophic heterotroph usually performs chemolithotrophy False
During the light reactions NADPH and ATP are produced. The NADPH will be used to create more ATP for fixing CO2 False
In the reaction H2S --> S; H2S is serving as an electron___________ Donor
For one glucose molecule how many ATP/GTP are created via substrate level phosphorylation when acetyl Co A feeds into the TCA cycle? 2
When the acetyl CoA that is created during Beta Oxidation feeds into the TCA cycle how many ATP/GTP are created via substrate level phosphorylation ? 1
If NO2- is the electron donor who could accept the electrons spontaniously? Fe3+
If H2S is the electron donor who could accept the electrons spontaniously? NO2- & Fe3+
If NO3- is the electron acceptor who could donate the electrons spontaniously? H2, H2S, & NADH
If NO2- is the electron acceptor who could donate the electrons spontaniously? H2, H2S, & NADH
You isolate a bacterium that oxidizes NO2- and reduces oxygen what type of metabolism could this be? Aerobic chemolithotrophy
You isolate a bacterium that oxidizes NO2- and reduces Fe3+ what type of metabolism could this be? Anaerobic chemolithotropy
You isolate a bacterium that reduces NO2- while oxidizing amino acids what type of metabolism could this be? Anaerobic respiration
You isolate a bacterium that reduces NO2- what type of metabolism could this be? Anaerobic respiration & Anaerobic chemolithotropy
What pathways will be used during anaerobic chemolithotrophy? Electron transport chain
What pathways will be used during fermentation? Glycolysis
What is the product of each “turn” of the beta oxidation cycle of lipid metabolism? 1 acetyl-CoA molecule, 1 NADH+ and 1 FADH2
If the next codon to be read in the mRNA is 5’ GCA 3’ the amino acid brought in will be A
If the next codon to be read in the mRNA is 5’ GAC 3’ the amino acid brought in will be D
If the next codon to be read in the mRNA is 5’ CUA 3’ the amino acid brought in will be L
If the anti-codon on the tRNA is 3’ UAC 5’ the amino acid added by aminoacyl tRNA synthetase will be M
If the anti-codon on the tRNA is 3’ CUA 5’ the amino acid added by aminoacyl tRNA synthetase will be D
If the anti-codon on the tRNA is 3’ GCA 5’ the amino acid added by aminoacyl tRNA synthetase will be R
If the anti-codon on the tRNA is 3’ GAC 5’ the amino acid added by aminoacyl tRNA synthetase will be L
The following is a diagram of DNA replication. The (1st) shorter arrows represent the primers, and the longer arrows represent the reproduced DNA. Where does ligase perform its function? at the site indicated by the arrow labeled A
DNA ligase forms phosphodiester bonds between the last RNA nucleotide removed on the RNA primer and the first DNA nucleotide of the Okazaki fragment
If you are producing a protein that has 73 amino acids how many ATP/GTP will be used in peptidyl transferase reactions? 72
For the translation of a 75 amino acid protein how many ATP/GTP will be used to add Amino acids onto tRNAs? 75
If you are producing a protein that has 73 amino acids how many ATP/GTP will be used to perform translocations? 72
For the translation of a 75 amino acid protein how many ATP/GTP will be used to perform translocations? 74
5’GTTTGCCACTTATGATTGCTCTATAATGTATGGAGTAGGAGCATGAATTTTTGTGAATAATATCGA 3’ 5' GUAGGAGCAUGAAUUUUUGUGAAUAAUAUCGA 3'
Created by: sdturner
Popular Bacteriology sets

 

 



Voices

Use these flashcards to help memorize information. Look at the large card and try to recall what is on the other side. Then click the card to flip it. If you knew the answer, click the green Know box. Otherwise, click the red Don't know box.

When you've placed seven or more cards in the Don't know box, click "retry" to try those cards again.

If you've accidentally put the card in the wrong box, just click on the card to take it out of the box.

You can also use your keyboard to move the cards as follows:

If you are logged in to your account, this website will remember which cards you know and don't know so that they are in the same box the next time you log in.

When you need a break, try one of the other activities listed below the flashcards like Matching, Snowman, or Hungry Bug. Although it may feel like you're playing a game, your brain is still making more connections with the information to help you out.

To see how well you know the information, try the Quiz or Test activity.

Pass complete!
"Know" box contains:
Time elapsed:
Retries:
restart all cards