click below
click below
Normal Size Small Size show me how
MIP-300 exam 3
| Question | Answer |
|---|---|
| In respiration, the initial electron donor is organic. | True |
| You are studying an organism that oxidizes glucose using anaerobic respiration. The electron donor is organic. | True |
| During fermentation, most of the ATP generated are created by oxidative phosphorylation during the ETC. | False |
| In fermentation, the final electron acceptor is inorganic. | False |
| In chemolithotrophy the initial electron donor can be... | Inorganic |
| Which of the following is true of anaerobic chemolithotrophy? | The final electron acceptor is an inorganic molecule other than oxygen & the ETC occurs |
| During the dark reaction of photolithotrophy, organic material is produced. | True |
| During the dark reaction of photolithotrophy, NADPH accepts electrons. | False |
| A microbe that gains energy by oxidizing fatty acids uses chemolithotrophy as its metabolism. | False |
| You isolate an organism that gains energy by oxidizing Fe2+ as an initial electron donor in the absence of sunlight. Which of the following metabolisms could it be using? | Chemolithotrophy |
| NADH -->NAD is an ___________ reaction | Oxidation |
| A chemolithotrophic autotroph usually performs the TCA cycle | False |
| Fermentation does not use an electron transport chain because there is no NAD to accept the electrons from the electron transport chain. | False |
| 2 orgs use of FADH2 (E0 = -0.18) as electron donor. Org. A uses ubiquinone (E0 = 0.10) as electron acceptor and organism B uses Fe3+ (E0 = 0.771).Org. B will produce more energy per electron donated to the electron transport chain than organism A. | False |
| During the light reactions NADPH feeds electrons into the electron transport chain to create the ATP that will be used to fix CO2. | False |
| In the reaction Fe3+ --> Fe2+; Fe3+ is serving as an electron___________ | Acceptor |
| Which of the pathways will be used during aerobic respiration? | Glycolysis, TCA cycle, & Electron transport chain |
| Which of the pathways will be used during anaerobic respiration? | Glycolysis, TCA cycle, & Electron transport chain |
| S--> H2S is an ___________ reaction | Reduction |
| Pyruvate or a derivative of pyruvate are reduced when they accept electrons from the electron transport chain when oxygen levels are low. | False |
| a chemoorganotrophic heterotroph usually performs chemolithotrophy | False |
| During the light reactions NADPH and ATP are produced. The NADPH will be used to create more ATP for fixing CO2 | False |
| In the reaction H2S --> S; H2S is serving as an electron___________ | Donor |
| For one glucose molecule how many ATP/GTP are created via substrate level phosphorylation when acetyl Co A feeds into the TCA cycle? | 2 |
| When the acetyl CoA that is created during Beta Oxidation feeds into the TCA cycle how many ATP/GTP are created via substrate level phosphorylation ? | 1 |
| If NO2- is the electron donor who could accept the electrons spontaniously? | Fe3+ |
| If H2S is the electron donor who could accept the electrons spontaniously? | NO2- & Fe3+ |
| If NO3- is the electron acceptor who could donate the electrons spontaniously? | H2, H2S, & NADH |
| If NO2- is the electron acceptor who could donate the electrons spontaniously? | H2, H2S, & NADH |
| You isolate a bacterium that oxidizes NO2- and reduces oxygen what type of metabolism could this be? | Aerobic chemolithotrophy |
| You isolate a bacterium that oxidizes NO2- and reduces Fe3+ what type of metabolism could this be? | Anaerobic chemolithotropy |
| You isolate a bacterium that reduces NO2- while oxidizing amino acids what type of metabolism could this be? | Anaerobic respiration |
| You isolate a bacterium that reduces NO2- what type of metabolism could this be? | Anaerobic respiration & Anaerobic chemolithotropy |
| What pathways will be used during anaerobic chemolithotrophy? | Electron transport chain |
| What pathways will be used during fermentation? | Glycolysis |
| What is the product of each “turn” of the beta oxidation cycle of lipid metabolism? | 1 acetyl-CoA molecule, 1 NADH+ and 1 FADH2 |
| If the next codon to be read in the mRNA is 5’ GCA 3’ the amino acid brought in will be | A |
| If the next codon to be read in the mRNA is 5’ GAC 3’ the amino acid brought in will be | D |
| If the next codon to be read in the mRNA is 5’ CUA 3’ the amino acid brought in will be | L |
| If the anti-codon on the tRNA is 3’ UAC 5’ the amino acid added by aminoacyl tRNA synthetase will be | M |
| If the anti-codon on the tRNA is 3’ CUA 5’ the amino acid added by aminoacyl tRNA synthetase will be | D |
| If the anti-codon on the tRNA is 3’ GCA 5’ the amino acid added by aminoacyl tRNA synthetase will be | R |
| If the anti-codon on the tRNA is 3’ GAC 5’ the amino acid added by aminoacyl tRNA synthetase will be | L |
| The following is a diagram of DNA replication. The (1st) shorter arrows represent the primers, and the longer arrows represent the reproduced DNA. Where does ligase perform its function? | at the site indicated by the arrow labeled A |
| DNA ligase forms phosphodiester bonds | between the last RNA nucleotide removed on the RNA primer and the first DNA nucleotide of the Okazaki fragment |
| If you are producing a protein that has 73 amino acids how many ATP/GTP will be used in peptidyl transferase reactions? | 72 |
| For the translation of a 75 amino acid protein how many ATP/GTP will be used to add Amino acids onto tRNAs? | 75 |
| If you are producing a protein that has 73 amino acids how many ATP/GTP will be used to perform translocations? | 72 |
| For the translation of a 75 amino acid protein how many ATP/GTP will be used to perform translocations? | 74 |
| 5’GTTTGCCACTTATGATTGCTCTATAATGTATGGAGTAGGAGCATGAATTTTTGTGAATAATATCGA 3’ | 5' GUAGGAGCAUGAAUUUUUGUGAAUAAUAUCGA 3' |