Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Micro Exam II SG
Molecular Biology, Genetic Regulation
| Question | Answer |
|---|---|
| What is a gene? | A section of information that can be coded into a protein to express certain phylogenic traits in a cell |
| What is mRNA? | messenger RNA; made as a reverse copy of DNA sequences to code for copies of DNA (DNA replication) |
| What is tRNA? | transfer RNA; codons in tRNA match with codons on mRNA to code for amino acids --> proteins |
| What is rRNA? | ribosomal RNA; structural backbone of ribosome - facilitates initiation - holds mRNA in place - positions subunits & tRNA on ribosome - catalyzes translation (peptide bonds) |
| What is replication? What's involved? | making copies of DNA sequences; ALWAYS goes from 5' to 3' end 1) formation of replication fork 2) synthesis of new strands 3) proofreading 4) termination |
| What is transcription? What's involved? | transfer of info from DNA to mRNA; RNA polymerase & sigma factor 1) sigma recognizes promoter & initiation site 2) transcription; sigma out; RNA chain grows 3) termination 4) release of polymerase & mRNA |
| What is translation? What's involved? | translating mRNA into respective amino acids --> protein; mRNA, tRNA, 50S + 30S, GTP, initiation/elong/termination factors 1) initiation 2) elongation (adding AA's, peptide bond) 3) translocation (tRNA moved 4) termination |
| What's the Wobble Concept? | The 3-nucleotide codon that tRNA codes for has some "wiggle room" for the third base pair - they don't have to be perfectly paired, sometimes they're not there. |
| What's an open reading frame? (ORF) | A part of mRNA that has a start codon, a series of codons, and a stop codon in the same reading frame. |
| What's codon bias? | some codons are preferred by tRNA even though multiple codons code for the same amino acid (favoritism) |
| What's an exon? | coding area; nucleotide sequence represented in the RNA molecule |
| What's an intron? | noncoding area; nucleotide sequence removed thru RNA splicing to produce a mature RNA molecule |
| What does monocystronic mean? | only contain one coding region (Eukarya) |
| What does polycystronic mean? | have more than one coding region (Prokarya) |
| What is complementary DNA? | the daughter DNA strand produced that forms DNA duplicate with parent strand |
| How/why is DNA an antiparallel structure? | HOW: each strand goes 5' to 3'; they have to oppose each other to be coded together WHY: [chemistry!] negatively charged phosphates want to be as far away as possible; pyrimidine & purine bases (ACTGU) want to H bond |
| Explain the double helix structure of DNA | one helical turn = 10bp; sugar phosphate backbone contains major groove & minor groove |
| What is a major groove in DNA? | the larger space between the backbones of 2 helices |
| What is a minor groove in DNA? | the smaller space between the backbones of 2 helices |
| Describe the backbone of DNA | alternating strand of pentose sugar deoxyribose + phosphate |
| What is the temperature of melting for DNA? (Tm) | 85.0*C |
| What is bent DNA? | several runs of 5-6 adenines divided by 4-5 other bases; helps regulate gene expression (AAAAAACTGTGAAAAAATTCGC) |
| What are inverted repeats? | sequences of nucleotide bases that are opposite and mirrored within a certain coding region on DNA |
| What is a stem-loop structure? | common structure in RNA; stem = short double helical sections that are base-paired w antiparallel strands loop = unpaired bases btwn the repeat units on the stem (the CURVE of the structure) |
| What is supercoiling? | the process of twisting DNA into condensed structures (in Prokarya); DNA is nicked, twisted, resealed over and over |
| What are histones? | positively-charged proteins (attracted to neg phosphates, neutralize charge on DNA); facilitate supercoiling in Eukaryotes |
| What is chromatin? | DNA + histones |
| What is heterochromatin? | highly condensed chromatin (compact storage of genetic info) |
| What is a genome? | The entire complement of an organism's genetic information (cell or virus) |
| What is a chromosome? | holds genes NEEDED for cellular functions (housekeeping genes) ex: genes for DNA polymerase & RNA polymerase |
| What does DNA gyrase do? | replaces supercoils ahead of the replisome (puts the backbone back together after DNA polymerase breaks it to unzip DNA) double helix --> (DNA polymerase) --> broken backbone, unwound helix --> (DNA gyrase) --> 2 single strands unwound but assembled |
| What is semiconservative replication? | the process of turning one DNA strand into 2 double helices -- each helix has 1 parent strand and 1 daughter strands (partially conserves original DNA) |
| What is a template strand? | a DNA strand that is copied during replication |
| What is origin-binding protein? (OBP) | protein that binds to the origin of replication (ORI); opens double helix to expose template strands |
| What is helicase? | an enzyme that unwinds DNA's dbl helix at the replication fork |
| What is a single-stranded binding protein? | stabilizes unwound strands of DNA to prevent it going back to a double helix (acts like a doorstop) |
| What is primase? | an enzyme that makes a short strand of RNA in complement to the exposed DNA template; 10-12 nucleotides |
| What is DNA polymerase III? What are its 5 subunits? | replaces primase & makes new DNA strand in place of RNA segments 1) sliding clamp - holds polymerase 2) clamp loader - loads polymerase 3) Tau subunit (dimerization) - holds core enzymes for L&L strands 4) polymerase (dnaE) 5) proofreading (dnaQ) |
| What is DNA polymerase I? What does it do? | enzyme that removes RNA primer & fills in gaps of DNA involved with proofreading of new DNA --> exonuclease function removes mistakes in sequence |
| What is proofreading? | checking for mistakes in the nucleotide sequence of new DNA strand |
| What is the origin of replication (ORI)? | a specific DNA sequence where replication is initiated (about 250 bases) |
| What is a replication fork? | the location where DNA strands are separated into template strands for replication (held in place by SSBP) |
| What is bidirectional replication? | since DNA can only code from 5' to 3', replication can only happen in one direction on the strand, so since they're arranged bidirectionally, replication must happen in opposing directions (meaning one strand is awkward and "backwards") |
| What is the leading strand? | the unwound strand of DNA being replicated in the "right direction", from 5' to 3' hydroxyl - continuous bc always free 3' OH - only needs one primer bc only initiates once |
| What is the lagging strand? | the unwound strand of DNA being replicated in the "wrong direction" - from 5' to 3' but noncontinuous bc no exposed 3' OH - needs more than one RNA primer (re-initiated several times) - Okazaki fragments = short segments produced |
| What is a Theta structure? | intermediate structure during replication of circular Prokaryotic DNA; 2 replication forks form and one strand makes the "theta" middle strand |
| What is DNA ligase? What does it do? | enzyme that seals nicks in DNA after replication by making a phosphodiester bond |
| What does the Tus protein do? | stops formation of the replication fork |
| What is Topoisomerase IV? What does it do? | enzyme that separates 2 copies of a chromosome |
| Describe the relationship between codons and genetic codes | Codons are like "words" that form "sentences" on RNA; certain genetic codes are transcribed into certain codons --> specific codons lead to specific amino acids; some are START or STOP codons |
| What is a degenerate code? What does it mean for genetics? | several different codons lead to the same amino acid ("overkill") this type of code promotes variation & more efficient translation |
| What is RNA polymerase? What are its 5 subunits? | catalyzes phosphodiester bonds between ribonucleotides core enzyme: 1) beta (B) 2) beta prime (B') 3) 2 copies of alpha 4) omega - assembles core enzyme 5) sigma factor - recognizes DNA promoter region |
| What is a constitutive enzyme? | an enzyme that is produced no matter what the environmental conditions are |
| What is post translational modification? | controlling activity of preexisting enzymes through 1) feedback inhibition or 2) covalent modification (removing/adding small molecule - adenylylation) |
| What is feedback inhibition? | a form of post-translational modification in which the end product inhibits further production (allosteric enzyme) |
| What is an allosteric enzyme? | an enzyme that changes conformation of its actives site to allow or prevent substrate binding (part of feedback inhibition) |
| What does the allosteric site on an allosteric enzyme do? | binds the end product of the allosteric enzyme |
| What does the active site on an allosteric enzyme do? | binds the substrate of the allosteric enzyme |
| What is an allosteric effector? | the end product of the allosteric enzyme that binds the allosteric site |
| What are DNA binding proteins? | proteins that interact with DNA to regulate transcription |
| What is a specific DNA binding protein? | a homodimeric protein - has 2 identical polypeptides that bind to inverted repeats in the double helix --> blocks already bound RNA polymerase from working |
| What is a nonspecific DNA binding protein? | blocks initial binding of RNA polymerase; interact with DNA to provide structure (as in nucleosomes) ex: histones (provide structure to DNA during supercoiling) |
| What is negative control? | regulatory mechanism that stops transcription; either repression or induction |
| What is repression? | the presence of a substrate will inhibit production of the enzyme |
| What is the difference between a repressor and corepressor? | repressor - binds to the operator & stops transcription corepressor - binds to repressor to partially/fully repress gene expression ex: arginine operon (arginine = corepressor that aids repressor) |
| What is induction? | the presence of a substrate will cause production of an enzyme; only impacts catabolic/degradative enzymes |
| What is the difference between a repressor and an inducer? | repressor - binds to the operator & stops transcription inducer - binds to repressor and prevents it from repressing gene expression |
| What is positive control? | regulatory mechanism in which an activator protein promotes transcription ex: maltose operon (maltose activator protein + inducer maltose) |
| What is catabolite repression? | positive control that involves activator proteins (catabolic enzymes); suppression of alternative catabolic pathways using a preferred fuel source |
| What is the catabolite activator protein (CAP)? | |
| What is the catabolite repressor protein (CRP)? | |
| What function does cyclic AMP (cAMP) have in catabolite repression? | |
| What is an operon? | |
| What is a promoter? | |
| What is an operator? | |
| What is diauxic growth? | |
| What does B-galactosidase do? | enzyme in the lac operon that cleaves beta-galactosidic bond AND rearranges lactose (beta-1,4 bond) into allolactose (beta-1,6 bond) |
| What is galactoside permease? What does it do? | enzyme in the lac operon that transports lactose into the cell |
| What are the 4 lac genes, and what do they do? | lacI - makes repressor monomer --> binds to operator & blocks RNA polymerase from transcribing lac genes lacZ - B-galactosidase --> cleaves bond, B-1,4 to B-1,6 lacY - galactoside permease --> lactose into cell lacA - galac-transacetylase --> unknown |
Created by:
eggarrett
Popular Biology sets