Save
Upgrade to remove ads
Busy. Please wait.
Log in with Clever
or

show password
Forgot Password?

Don't have an account?  Sign up 
Sign up using Clever
or

Username is available taken
show password


Make sure to remember your password. If you forget it there is no way for StudyStack to send you a reset link. You would need to create a new account.
Your email address is only used to allow you to reset your password. See our Privacy Policy and Terms of Service.


Already a StudyStack user? Log In

Reset Password
Enter the associated with your account, and we'll email you a link to reset your password.
focusNode
Didn't know it?
click below
 
Knew it?
click below
Don't Know
Remaining cards (0)
Know
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.

  Normal Size     Small Size show me how

Stack #79818

Question:Answer:
Name three ways in which RNA differs from DNA 1. RNA is single stranded while DNA is double stranded 2. RNA nucleotides contain the sugar ribose while DNA contains deoxyribose (ribose contains an extra oxygen molecule) 3. RNA contains uracil which DNA contains thymine p.208
uracil Nitrogen base found in RNA. During transcription of DNA into RNA uracil (U) pairs with adenine (A). p.208
transcription The process of converting DNA into RNA. This process occurs in the cell nucleus. p.208
translation The process of converting RNA into a protein. This occurs in the cytoplasm of a cell. p.208
RNA polymerase an enzyme that adds and links complementary RNA nucleotides during transcription p.209
mRNA form of RNA which carries the instructions for making a protein from the cell nucleus to the cytoplasm p.211
tRNA Molecules that carry a specific amino acid to the site of translation. p.212
natural selection Organisms with traits well suited to their environment survive and reproduce at a greater rate than less well-adapted organisms in the same environment
adaptation An inherited trait that has become common in a population because that trait provides a selective advantage.
name 3 pieces of evidence which support evolution 1.the fossil record 2.anatomy and development 3. biological molecules (see p.283,286 and 287 for details)
species A group of organisms thast are closely related and naturally mate to produce fertile offspring.
homologous structures anatomical structures which share a common ancestry p.286
vestigial structures a structure in an orgasnism that is reduced in size and function and that may have been complete and functional in the organism's ancestors. p.286
name the 4 important factors which drive natural selection 1.all populations have genetic variation 2.the environment presents challenges to successful reproduction 3.individuals tend to produce more offsrping than the environment can support 4. some individuals are better able to cope with challenges p.288
transcribe this sequence: TACGGACGTTAACGGTAGATC AUGCCUGCAAUUGCCAUCUAG
Translate the following mRAN sequence: AUGCCUGCAAUUGCCAUCUAG Met-Pro-Ala-Ile-Ala-Ile-stop
When DNA is transcribed, a strand of _______________ is created. mRNA
When mRNA is translated,_______________ are strung together to create a _______________. Amino acids are strung together to create a protein.
True or False: A codon signifies either a specific amino acid or a stop signal. True
True or False: Natural selection can cause the spread of an advantageous adaptation throughout a population over time. True
True or False: The fossil record suggests that species have become less complex over time. False: The fossil record suggests that species have become MORE complex over time.
True or False: Early in development, human embryos and the embryos of all other vertebrates are strikingly similar. True, think back on the pictures we cut out of the developing fish, chick, cow and human
True or False: The environment selects which organisms will survive and reproduce by presenting challenges that only individuals with particular traits can meet. True
True or False: A genus is the smallest taxonomic group into which an organism can be assigned. False: A SPECIES is the smallest taxonomic group into which an organism can be assigned.
You are a biologist accompanying some other scientists on an expedition in a region that has not been studied intensively. In your explorations, you come across a colony of small vertebrates that do not look familiar to you. After conducting electronic se 1.Analysis of anatomical structures and comparison of these to similar structures of other vertebrates is one type of data that should be collected. 2.Analysis of the DNA and/or a protein 3.Analysis of embryonic development and comparison of structures
Describe why the following statement is not accurate:Many human beings must have their appendix removed during their life time due to the possibility of it rupturing. Therefore, any children that these people have will not have an appendix. There must be a change in the DNA in order for that trait to be passed on and spread throughout a population.
Sperm and eggs are both__________. haploid
The midpiece of a sperm cell contains many ____, which supply sperm with the energy needed to propel themselves through the female reproductive system. mitochondria
In what way are mature human sperm and eggs similar? They both have the same number of chromosomes in their nuclei.
ovum mature egg cell
sperm male gamete
uterus The muscular structure in which the fetus develops
fallopian tubes tubes that extend from the ovaries to each side of the uterus, through which the egg travels.
corpus luteum The ruptured follicle that is left in the ovary after ovulation
implantation The attachment of an embryo into the uterine wall
True or False: Arteries contain valves that prevent the backward flow of blood. False: VEINS contain valves that prevent the backward flow of blood.
What occurs when the diaphragm and the rib muscles contract? inhalation
People with B antigen on their red blood cells can give blood to someone with blood type(s) B and AB.
Hypertension another name for high blood pressure
Pulmonary circulation flows to and from the_____ lungs
Is the blood entering the right atrium oxygenated or deoxydenated? deoxydenated
Oxygen poor blood is pumped to the lungs via the pulmonary arteries
An abnormality involving the platelets would probably affect the process of blood clotting
If a blood vessel has valves, it probably is a__________ vein
white blood cells Defend the body against bacterial infection and invasion by foreign substances
diaphragm The dome-shaped muscle below the chest cavity
pistil the collective term for the carpel(s). Each carpel includes an ovary (where the ovules are produced; ovules are the female reproductive cells, the eggs), a style (a tube on top of the ovary), and a stigma (which receives the pollen during fertilization).
stamen the male reproductive parts of flowers. A stamen consists of an anther (which produces pollen) and a filament. The pollen consists of the male reproductive cells; they fertilize ovules.
stigma recieves pollen during fertilization
anther the pollen producing sac of a flower
sepal protect the flower from damage when it is a bud
style stalk which rises from the ovary in a flower
Capillaries tiny blood vessels that allow the exchange of gases, nutrientes, hormones and other molecules in the blood
name 5 different types of molecules that are transported via the cardiovascular system nutrients, oxygen, metabolic waste, hormones and heat
lymphatic system collects and recycles fluids leaked from the cardiovascular system, and is involved in fighting infection
red blood cells carry oxygen, hemoglobin in red blood cells is the molecule which allows oxygen to bind
ventricles the chambers of the heart that pump blood to the lungs and to the rest of the body
alveoli tiny air sacs in the lungs which allow for gas exchange
bile A substasnce produced by the liver and stored in the gallbladder. Bile helps breat fats into tiny droplets. (think about the oil/soap mini-lab)
villi Finger like projections in the small intestine which allow for an increase in the rate of nutrient absorption.
The kidneys play a major role in maintaining___________. homeostasis by removing urea, water, and other wastes from the blood
The first stage of gene expression is called ____________________. transcription
During translation, amino acids are strung together by molecules of ____________________. tRNA
Natural selection leads to changes in both the physical appearance and the ____________________ ____________________ of a species. genetic makeup
The lower opening of the uterus is called the ____________________. cervix
The release of an egg from an ovary is called ____________________. ovulation
Gonorrhea and chlamydia can usually be cured with ____________________. antibiotics
The primary role of hemoglobin in the blood is to carry ____________________. oxygen
Antigens determining blood type are carried on the surface of ____________________ ____________________ cells. red blood cells
calorie a unit of energy that indicates the amount of heat energy contained in food.
name the organs of the digestive tract The mouth, esophagus,stomach, small intesting and large intestine(colon)
In the liver, ammonia is converted to a much less toxic nitrogen waste called ____________________. urea
Each kidney contains over 1 million blood-cleaning units called ____________________. nephrons
A male gametophyte of a seed plant develops into a(n) ____________________ ____________________. pollen grain
Created by: ahayward
Popular Biology sets

 



Voices

Use these flashcards to help memorize information. Look at the large card and try to recall what is on the other side. Then click the card to flip it. If you knew the answer, click the green Know box. Otherwise, click the red Don't know box.

When you've placed seven or more cards in the Don't know box, click "retry" to try those cards again.

If you've accidentally put the card in the wrong box, just click on the card to take it out of the box.

You can also use your keyboard to move the cards as follows:

If you are logged in to your account, this website will remember which cards you know and don't know so that they are in the same box the next time you log in.

When you need a break, try one of the other activities listed below the flashcards like Matching, Snowman, or Hungry Bug. Although it may feel like you're playing a game, your brain is still making more connections with the information to help you out.

To see how well you know the information, try the Quiz or Test activity.

Pass complete!
"Know" box contains:
Time elapsed:
Retries:
restart all cards