Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Stack #79818
| Question: | Answer: |
|---|---|
| Name three ways in which RNA differs from DNA | 1. RNA is single stranded while DNA is double stranded 2. RNA nucleotides contain the sugar ribose while DNA contains deoxyribose (ribose contains an extra oxygen molecule) 3. RNA contains uracil which DNA contains thymine p.208 |
| uracil | Nitrogen base found in RNA. During transcription of DNA into RNA uracil (U) pairs with adenine (A). p.208 |
| transcription | The process of converting DNA into RNA. This process occurs in the cell nucleus. p.208 |
| translation | The process of converting RNA into a protein. This occurs in the cytoplasm of a cell. p.208 |
| RNA polymerase | an enzyme that adds and links complementary RNA nucleotides during transcription p.209 |
| mRNA | form of RNA which carries the instructions for making a protein from the cell nucleus to the cytoplasm p.211 |
| tRNA | Molecules that carry a specific amino acid to the site of translation. p.212 |
| natural selection | Organisms with traits well suited to their environment survive and reproduce at a greater rate than less well-adapted organisms in the same environment |
| adaptation | An inherited trait that has become common in a population because that trait provides a selective advantage. |
| name 3 pieces of evidence which support evolution | 1.the fossil record 2.anatomy and development 3. biological molecules (see p.283,286 and 287 for details) |
| species | A group of organisms thast are closely related and naturally mate to produce fertile offspring. |
| homologous structures | anatomical structures which share a common ancestry p.286 |
| vestigial structures | a structure in an orgasnism that is reduced in size and function and that may have been complete and functional in the organism's ancestors. p.286 |
| name the 4 important factors which drive natural selection | 1.all populations have genetic variation 2.the environment presents challenges to successful reproduction 3.individuals tend to produce more offsrping than the environment can support 4. some individuals are better able to cope with challenges p.288 |
| transcribe this sequence: TACGGACGTTAACGGTAGATC | AUGCCUGCAAUUGCCAUCUAG |
| Translate the following mRAN sequence: AUGCCUGCAAUUGCCAUCUAG | Met-Pro-Ala-Ile-Ala-Ile-stop |
| When DNA is transcribed, a strand of _______________ is created. | mRNA |
| When mRNA is translated,_______________ are strung together to create a _______________. | Amino acids are strung together to create a protein. |
| True or False: A codon signifies either a specific amino acid or a stop signal. | True |
| True or False: Natural selection can cause the spread of an advantageous adaptation throughout a population over time. | True |
| True or False: The fossil record suggests that species have become less complex over time. | False: The fossil record suggests that species have become MORE complex over time. |
| True or False: Early in development, human embryos and the embryos of all other vertebrates are strikingly similar. | True, think back on the pictures we cut out of the developing fish, chick, cow and human |
| True or False: The environment selects which organisms will survive and reproduce by presenting challenges that only individuals with particular traits can meet. | True |
| True or False: A genus is the smallest taxonomic group into which an organism can be assigned. | False: A SPECIES is the smallest taxonomic group into which an organism can be assigned. |
| You are a biologist accompanying some other scientists on an expedition in a region that has not been studied intensively. In your explorations, you come across a colony of small vertebrates that do not look familiar to you. After conducting electronic se | 1.Analysis of anatomical structures and comparison of these to similar structures of other vertebrates is one type of data that should be collected. 2.Analysis of the DNA and/or a protein 3.Analysis of embryonic development and comparison of structures |
| Describe why the following statement is not accurate:Many human beings must have their appendix removed during their life time due to the possibility of it rupturing. Therefore, any children that these people have will not have an appendix. | There must be a change in the DNA in order for that trait to be passed on and spread throughout a population. |
| Sperm and eggs are both__________. | haploid |
| The midpiece of a sperm cell contains many ____, which supply sperm with the energy needed to propel themselves through the female reproductive system. | mitochondria |
| In what way are mature human sperm and eggs similar? | They both have the same number of chromosomes in their nuclei. |
| ovum | mature egg cell |
| sperm | male gamete |
| uterus | The muscular structure in which the fetus develops |
| fallopian tubes | tubes that extend from the ovaries to each side of the uterus, through which the egg travels. |
| corpus luteum | The ruptured follicle that is left in the ovary after ovulation |
| implantation | The attachment of an embryo into the uterine wall |
| True or False: Arteries contain valves that prevent the backward flow of blood. | False: VEINS contain valves that prevent the backward flow of blood. |
| What occurs when the diaphragm and the rib muscles contract? | inhalation |
| People with B antigen on their red blood cells can give blood to someone with blood type(s) | B and AB. |
| Hypertension | another name for high blood pressure |
| Pulmonary circulation flows to and from the_____ | lungs |
| Is the blood entering the right atrium oxygenated or deoxydenated? | deoxydenated |
| Oxygen poor blood is pumped to the lungs via the | pulmonary arteries |
| An abnormality involving the platelets would probably affect the process of | blood clotting |
| If a blood vessel has valves, it probably is a__________ | vein |
| white blood cells | Defend the body against bacterial infection and invasion by foreign substances |
| diaphragm | The dome-shaped muscle below the chest cavity |
| pistil | the collective term for the carpel(s). Each carpel includes an ovary (where the ovules are produced; ovules are the female reproductive cells, the eggs), a style (a tube on top of the ovary), and a stigma (which receives the pollen during fertilization). |
| stamen | the male reproductive parts of flowers. A stamen consists of an anther (which produces pollen) and a filament. The pollen consists of the male reproductive cells; they fertilize ovules. |
| stigma | recieves pollen during fertilization |
| anther | the pollen producing sac of a flower |
| sepal | protect the flower from damage when it is a bud |
| style | stalk which rises from the ovary in a flower |
| Capillaries | tiny blood vessels that allow the exchange of gases, nutrientes, hormones and other molecules in the blood |
| name 5 different types of molecules that are transported via the cardiovascular system | nutrients, oxygen, metabolic waste, hormones and heat |
| lymphatic system | collects and recycles fluids leaked from the cardiovascular system, and is involved in fighting infection |
| red blood cells | carry oxygen, hemoglobin in red blood cells is the molecule which allows oxygen to bind |
| ventricles | the chambers of the heart that pump blood to the lungs and to the rest of the body |
| alveoli | tiny air sacs in the lungs which allow for gas exchange |
| bile | A substasnce produced by the liver and stored in the gallbladder. Bile helps breat fats into tiny droplets. (think about the oil/soap mini-lab) |
| villi | Finger like projections in the small intestine which allow for an increase in the rate of nutrient absorption. |
| The kidneys play a major role in maintaining___________. | homeostasis by removing urea, water, and other wastes from the blood |
| The first stage of gene expression is called ____________________. | transcription |
| During translation, amino acids are strung together by molecules of ____________________. | tRNA |
| Natural selection leads to changes in both the physical appearance and the ____________________ ____________________ of a species. | genetic makeup |
| The lower opening of the uterus is called the ____________________. | cervix |
| The release of an egg from an ovary is called ____________________. | ovulation |
| Gonorrhea and chlamydia can usually be cured with ____________________. | antibiotics |
| The primary role of hemoglobin in the blood is to carry ____________________. | oxygen |
| Antigens determining blood type are carried on the surface of ____________________ ____________________ cells. | red blood cells |
| calorie | a unit of energy that indicates the amount of heat energy contained in food. |
| name the organs of the digestive tract | The mouth, esophagus,stomach, small intesting and large intestine(colon) |
| In the liver, ammonia is converted to a much less toxic nitrogen waste called ____________________. | urea |
| Each kidney contains over 1 million blood-cleaning units called ____________________. | nephrons |
| A male gametophyte of a seed plant develops into a(n) ____________________ ____________________. | pollen grain |
Created by:
ahayward
Popular Biology sets