Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Bio 114 Midterm
| Question | Answer |
|---|---|
| Q1. Which of the below would you use to measure 50 ml of liquid? | 100 ml Graduated Cylinder |
| Q2. The glassware used to titrate solutions is called? | Buret |
| In the IKI test experiment, which tube was the positive control? | starch |
| What does a Spectronic 20 measure? | The Spectronic 20 is a type of Spectrophotometer (but you knew that) that measures the amount of light passing thru a sample. |
| At what pH does phenophalein become colorless? | Phenopthalein changes from from pink to clear at pH values greater than 7 (> 7) |
| Taxis can be defined as..? | Taxis can be defined as deliberate movements toward or away from a stimulus or environment. |
| What is the Independent variable in the Moist/Dry experiment shown in the animation? | moisture |
| What Physiological reason(s) could an animal have for chosing a specific environment? | Physiological reasons are those having to do with an organimsms metabolism |
| Which organism are the Pill bugs more closely related to ? | shrimp |
| Glucose in the urine, glycosuria, can be an indicator of Diabetes. Which test would you use to test suspect urine for the presence of sugars? | Benedict's is the test for sugars |
| In the presence of monosaccharides IKI will turn what color? | no change |
| . Carbohydrates are particularly important in biological systems as...? | Energy & structure |
| What reagent was used to precipitate the DNA ? | Ethanol |
| What reagent was used to "resuspend" the DNA? | Saline Citrate |
| What reagent was used to indicate the presence of DNA? | You said Diphenylamine was used to indicate the presence of DNA |
| To which substances was the dialysis tubing permeable? | Chloride Ion/Sulphate Ion |
| To which substances was the tubing impermeable? | Starch/Protein |
| Why were these substances able to move thru the bag? | differences in Size |
| During dialysis, what substances would you want to remove from the bloodstream? What substances would you want to remain in the bloodstream? | This is a complex question since there are a myriad of different salts proteins, carbohydrates, lipids, and Urea in the bloodstream. The primary substance you we would want to remove is Urea. So you would dialyze against (outside the bag) a solution conta |
| . What was in the Digestive Buffer? What is it you are "Digesting"? | The Digestive buffer contain enzymes that "eat" the cell wall of the bacteria. To get at the DNA (which is what we are trying to do) you have "break-open" the bacteria. You do this with enzymes. The Buffer also contains water and salts, etc. Stuff that a |
| What is PCR? | PCR is an abbreviation for the Polymerase Chain Reaction. PCR is a technique that allows many copies of DNA to be made |
| What are “primers”? | Pimers are small pieces of DNA that specifically bind to the DNA you want to amplify (via PCR). The enzme that synthesizes DNA during the PCR process requires a starting point. The primers serve as that starting point. |
| What is sequencing? | (DNA) sequencing means determining the order of nucleotides in a DNA chain (like CCTAAGTCTAGGATCA). The DNA sequence can be used to identify an organism or idividual. DNA sequencing is now performed by machines. |
| How did you do “sequence matching”? | Sequence Analys is when a DNA sequence compared with all other known rDNA sequences for identification. This is done by computers that have large databases of DNA sequences stored in them. The computer compares a sample to those in the database looking fo |
| What is the natural history of an organism? | Natural History descibes the habitat, food, behavior and other interesting facts of an organism. |
| The top of a meniscus is used to determine the volume of liquid in a pipet. | false |
| Pill bugs live in moist habitats because...? | they breath with gills |
| The variable being changed or investigated by the experimenter is called the ? | Independent Variable |
| Nucleotides are composed of ...? | A Phosphate Group, a Sugar, and a Base. |
| The four Nucleotides that make up DNA are called...? | A T C G |
| The four different types of bases found in DNA are | A T C G |
| A carbohydrate is an organic compound that is composed of atoms of Carbon, Hydrogen and Oxygen in a ratio of ......? | 1:2:1 |
| About how many Genes does a Human have? | 50000 |
| Complex Carbohydrates, formed by linking many sugars together to form long or very long sugar chains, are called..? | Polysaccharides |
| The Nutrition facts for this food item state that there are 31 grams (total) of Carbohydrate; 3 g of Dietary Fiber, 5 g of sugars. What are the other 24 g of Carbohydrate? | To answer this one, You need to remember the type of tests we performed for Carbohydrates. For sugars, we used the Benedict's test, For Starch, we used the IKI test. Both sugars and starch are carbohydrates, so the remaining non-sugar carbohydrates in th |
| The Drosphila mutant phenotypes used in last week's lab were concerned with....? | wing shape |
| The feeding stage of a fruit fly consists of three subdivisions called ....? | instars |
| fly shown below is a male | Males are slightly smaller, has "sex combs" on their front legs, and have darker abdomens |
| Which of the below are posible genotypes of a wild type fly? Check all that apply. | +v ++ +a |
| In our cross between a wild type male fly and a vestigial female fly, all the F1 offspring were wild type. Why were there no vestigial flies? | The wildtype male was homozygous dominant(++). The vestigial femalemale was also homozygous (but recessive)(vv). The F1 offspring were all +v and since vestigial is a recessive trait. All the offspring had a wildtpye phenotype. |
| What determines your traits (i.e., how do you acquire them)? | Your traits are specified by genes. You inherit genes from your parents, not traits. |
| A person with a genotype where the genes for a particular trait are identical (e.g. GG or gg) would be called | homozygous, homozygous dominant, or homozygous recessive |
| A gene where only one copy need be present for the corresponding phenotype to be manifest is called ...?( | dominant |
| The Hairline trait called "widow's peak" is recessive | false |
| All traits are governed by either a dominant gene or a recessive gene. | false, Many traits are determined by multiple genes and/or codominant genes |
| Briefly describe how step 2 was performed. Basic Steps 1. Prepare a sample from a patient and isolate whole bacterial DNA. 2. Make many copies of the desired piece of DNA. 3. Sequence the DNA. 4. Analyze the sequence and identify the bacteria. | In our case we used PCR (Polymerase Chain Reaction). PCR is one technique that allows many copies of DNA to be made. Before the advent of PCR, making sufficient copies of DNA for sequencing was a tedious process. |
| What is meant by the term "Sequence Homology"? | Sequence homology refers to how alike to DNA fragments are. This is determined by Sequence analysis using computer programs that program provide "similarity scores". |
| In the HHMI virtual lab, How did they denature the Digestive Buffer? | heat |
| The image below shows a PCR reaction occurring. What do the Orange and Green rectangles represent? | PCR primers |
| The image below shows a complete PCR cycle sequencing reaction. What do the Yellow, Blue, Red, and Green Structures on the left side of the amplification product (reults) represent? | Fluorescence-tagged Nucleotide Terminators |
| The image below shows a PCR reaction occurring. What do the Blue rectangles represent? | DNA polymersae |
| Briefly describe how step 4 was performed. Basic Steps 1. Prepare a sample from a patient and isolate whole bacterial DNA. 2. Make many copies of the desired piece of DNA. 3. Sequence the DNA. 4. Analyze the sequence and identify the bacteria. | DNA sequences are analyzed by comparing each sequence with all other known sequences. The sequences to be campared are storred in large dtabases. The matching involves database searching and alignment of sequences |
| What does the following series of letters represent? AACGAACGCTGGCGGCAGGCTTAACACATGCAAGTCGA GCGCACCTTTTAGAGTGAGCGGCAAACGGGTGAGTAAC GCGTGGGAATCTACCCATCTCTACGGAATAACACAGAG AAATTTGTGCTAATACCGTATACGTCCTATTTGGAGAA AGATTTATCGGAGATGGATGAGCCCGCGTTGGATTAGC TAGTTGG | It is a sequence of nucleotides, a fragment of DNA. |
| What does PCR stand for? | Polymerase Chain Reaction |
| In the Enzyme Lab, less product formed, meant a slower rate of reaction. | true |
| The substrate for the Enzyme we used in lab (Catalase) was? | pereoxide |
| A change in an Enzymes tertiary structure, caused by Heat or pH extremes, that cause the Enzyme to cease function is called | Denaturation is a change in the tertiary structure of an Enzyme due to temperature or pH. |
| In the Dialysis Lab exercise some substances were able to move through the bag into the Beaker and vice versa. Explain. | Semi permeable membranes (like our dialysis tubing) block the transport of some molecules and not others. This is usually dependent on the size of the pores in the tubing and the size of the molecules trying to pass through the bag. |
| In the Enzyme Lab, Why did we add H2SO4 to the tubes? Answer | to stop the reaction |
| How does the size of a molecule affect diffusion rates? | Diffusion rates are dependent on both the size and concentration of the diffusing molecules. Big molecules diffuse more slowly than small. |
| Define the term "hypotonic". | A solution has a solute concentration lower than that of another |
| In the Diffusion experiment shown below, the two parameters (independent variables)examined were | Molecular Size & Concentration |
Created by:
1339116787
Popular Biology sets