Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
MicroBio Exam 2
| Question | Answer |
|---|---|
| At the molecular level, how is a proton gradient generated by the quinone loop? | The quinone donates both H+and electrons, but FeS proteins only accept electrons |
| Compared to mitochondrial ETS (electron transport systems), bacterial ETS _____. | use a much greater variety of terminal electron acceptors |
| In oxygenic photosynthesis, as practiced in bacteria _____ | There are two electron transport chains |
| Why are purple sulfur bacteria considered metabolically unique? | They must perform reverse electron transport to make NADH. |
| How are respiratory and photosynthetic electron transport chains similar? | Both use heme-containing electron carriers |
| Purple sulfur bacteria (PSB) must use reverse electron transport, but green sulfur bacteria (GSB) do not. Why is there a difference? | GSB use a bacteriochlorophyll with enough energy to donate its electrons directly to ferredoxin |
| Which of the following is true for all electron carriers? | They must be capable of being oxidized and reduced |
| During oxygenic photosynthesis, the terminal electron acceptor for the electron transport chain involving photosystem II and plastoquinone is ______. | the reaction center of photosystem I |
| Which of the following is similar in all three photosynthetic mechanisms we discussed? | the way ATP is formed |
| Which of the following statements correctly describes the molecule at right? | it carries only electrons, not H+ |
| Which of the following is true of the mitochondrial electron transport system in eukaryotes, but NOT always true of bacterial electron transport systems? | cytochrome c oxidase is always the final electron transport complex |
| Some photosynthetic bacteria need to generate reducing power by reverse electron transport because ____. | their photosynthetic electron acceptor lacks the energy to donate electrons to NAD+ |
| Why do most photosynthetic bacteria produce a complex containing antenna pigments? | it allows them to channel additional photons of light to the reaction center |
| During a reaction in the electron transport chain, an electron acceptor ______ | must be reduced by the electron donor |
| In an electron transport chain, proteins 1 and 2 (P1 and P2) are structured as shown in the diagram. Which of the following most accurately describes the roles of these proteins? | P1 contributes H+to the PMF, but P2 does not |
| Which of the following correctly describes the direct mechanism of chemiosmotic ATP synthesis? | Energy from a H+gradient turns a rotor to push ADP and ~P together. |
| The following electron transport chain . . . | is a type of respiration |
| The goal of reverse electron transport, as carried out by purple photosynthetic bacteria, is to _____. | make NADH |
| Why is it important that some electron carriers carry both electrons and protons, while others carry only electrons? | This is how the Q loop pumps protons across a membrane |
| Which of the following statements most accurately compares how ATP is generated during cyclic versus non-cyclic photosynthesis (PS)? | ATP is produced by the same mechanism during cyclic PS as it is during non-cyclic PS |
| When comparing green sulfur and purple sulfur bacteria _____ | purple sulfur bacteria have a lower energy photosystem than green sulfur bacteria do |
| The outline of oxygenic photosynthesis is shown, with electron transfer steps marked 1 through 5. Which step is responsible for generation of reducing power | Electron transfer #5 |
| The use of an organic electron acceptor without producing a PMF from the electron transfer is known as _____ | fermentation |
| How does electron transport lead to the formation of a proton gradient? | One member of the transport chain is reduced by both H+and electrons, but only the electrons are passed to the next member |
| What is meant by oxidative phosphorylation? | Production of ATP from the PMF using ATP Synthase |
| Why is non-cyclic photosynthesis also called "oxygenic" photosynthesis? | The electron donor for PSII is H2O. |
| Compare oxygenic photosynthetic (OPS) and respiratory (RES) electron transport chains | They both use quinones and cytochromes in a Q-loop to produce a PMF |
| The chemical DCCD binds irreversibly to the proton binding site of the FOF1 ATP Synthase. What is the most likely consequence if DCCD is added to a culture of a facultative anaerobe? | The flagellar rotation speed would briefly increase due to a larger PMF. |
| How does oxidative phosphorylation make ATP? | It oxidizes electron carriers to make a PMF |
| When asked to sketch the reaction scheme for green sulfur photosynthetic bacteria on an exam one year, a student presented the diagram at right. I tried to find something he got correct to give him some credit. What did he get correct? | The way NADPH is produced directly |
| A major difference between quinones and hemes in the electron transport chain is that _____. | quinones accept and donate both H+and electrons; hemes only electrons |
| Which of the following is NOT important in a bacterial electron transport chain when creating a PMF? | Having oxygen as the terminal electron acceptor |
| How could you best determine whether an unknown respiratory chain was from a bacterium or from a eukaryotic mitochondrion? | Whether a different magnitude of PMF can be produced under different conditions |
| Which of the following best describes how ATP is produced by oxidative phosphorylation? | The PMF turns a rotor which pushes ADP and phosphate together |
| What are the appropriate mechanisms by which excited electrons dissipate their energy and revert to the ground state among the provided options? | A. Utilization of excess energy to facilitate chemical reactions B. Transference of energy to adjacent molecules, elevating electrons to higher energy levels C. fluorescence D. A and B E. All of the followings are correct *** correct |
| You notice a “rotten egg” smell coming from the black goo in the iron drain pipe in your kitchen. You could get rid of the smell by adding which of the following? | Sulfur oxidizing bacteria |
| Nitrifying bacteria cause a high biological oxygen demand (BOD) in a pond . . . | when NH4+is present, since they metabolize it with O2 as the electron acceptor |
| Rhizobium produces leghemoglobin . . . | to bind O2in order to protect nitrogenase |
| Which of the following uses mainly fats and oils as carbon sources, producing acids and CO2 by fermentation? | Propionibacterium |
| If you see the following structure on a plant, you could conclude that . . . | The plant is producing food for a bacterium |
| This bacterium lives in packets of four cells, two of which have their DNA tightly surrounded by a protein ring that protects it against extreme levels of radiation. | Deinococcus |
| You live near a swamp, and notice the “rotten egg” smell of H2S. Having taken micro, you decide to bacterially remediate the odor. Which of the following bacterial types would NOT be able to do the job if added to the swamp? | Sulfate reducing bacteria |
| What bacteria carry out the reaction marked "A" in the nitrogen cycle? | Denitrifying bacteria |
| Because it has a large number of modular catabolic pathways that produce intermediates that feed into glycolysis, this bacterium can catabolize almost anything. It is often used to break down environmental pollutants in the process of bioremediation. | Pseudomonas |
| Agrobacterium tumifaciens is especially important to plant scientists. What is so special about it? | It can be used to insert foreign DNA into plant cells. |
| This bacterium produces CO2 and acids from growth on fats and oils, such as are present on your skin in hair follicles | Propionibacterium |
| You're an engineer working on a bridge repair project. You notice that the buried iron bridge supports are coated in black, smelly ooze. What could you conclude is present in the soil? | Sulfate |
| The free-living nitrogen fixing bacterium Azotobacter has a much higher rate of cellular respiration than other bacteria. Why? | To protect the enzyme nitrogenase from oxygen |
| The bacterium Agrobacterium tumifaciens is very important in plant biology. Why? | It inserts a plasmid into plant cells, and can therefore be used in genetic engineering |
| This bacterium has well defined stalked and flagellated poles, which interchange in alternate generations of its life cycle, as shown | Caulobacter |
| Sulfate reducing bacteria . . . | produce sulfide, which forms a black precipitate on buried iron surfaces |
| Which of the following bacteria carry out fermentations important to the food industry in the production of dairy products and sauerkraut? | Lactic Acid Bacteria |
| Which of the following would be the most appropriate term to put in the box marked "????" in the image at the right? | nitrification |
| What problem do all nitrogen fixing bacteria have in common? | They are aerobes, but nitrogenase is damaged by oxygen. |
| Sulfur oxidizing bacteria . . . | produce H2SO4, and are therefore often acidophiles |
| In the diagram of the Nitrogen cycle at the right, which of the following bacteria could carry out the indicated step? | Azotobacter |
| Which of the following are famous for their ability to sense the presence of other bacteria, secrete slime trails and aggregate together by social gliding motility into large, complex, spore-producing structures called "fruiting bodies." | Myxobacterium |
| Some bacteria contain a large piece of circular DNA called the Ti plasmid. What is the purpose of this plasmid? | to make an infected plant produce nutrients for the bacterium |
| The bacterium Caulobacter crescentus is well known for its ability to . . . | distinguish one end of its cell (stalk) from the other (flagella) |
| Which of the following is an accurate comparison between sulfate reducing bacteria (SRB) and sulfur oxidizing bacteria (SOB)? | SRB are generally undesirable; SOB can be used in biomining of sulfide ores. |
| Important industrial production of acetone, butanol and other organic solvents depends on . . . | Clostridial fermentation |
| To check the quality of an agricultural soil you sometimes pull up certain plants and look for pink lumpy structures on the roots. What do these structures indicate? | the soil is rich in a form of nitrogen that plants can use |
| Which of the following reactions is carried out by methanogenic Archaea? | CO2is reduced to CH4 using electrons from H2 |
| Which of the following is true about Sulfate Reducing Bacteria? | Their presence in anaerobic soil is indicated by a "rotten egg" odor. |
| Which of the following bacteria both carry out fermentation reactions that are used in the preparation of important food products? | Lactococcus and Propionibacterium |
| You notice that one part of a plant is covered with small pinkish spherical structures, as shown in the picture at right. What can you conclude? | The spherical structures contain the enzyme nitrogenase |
| Purple nonsulfur bacteria can grow both aerobically and anaerobically, but they use different biochemical mechanisms to do so. How do these bacteria obtain reducing power when they are growing anaerobically? | by using a photosynthetic PMF to reverse a part of the electron transport chain |
| Which of the following are typically lithotrophs? | Nitrifying Bacteria |
| How does Clostridial ABE fermentation differ from the lactic acid fermentation performed by many other bacteria? | ABE fermentation can produce some additional ATP. |
| Deinococcus bacteria can be found uniquely in what environment? | Very high radiation levels |
| What bacteria would you expect to find in dense, pink or red clusters associated with plants? | Rhizobium |
| What is Agrobacterium noted for? | Natural insertion of DNA into plant cells |
| You are a soil scientist trying to bioremediate (use bacteria to clean up) an area of soil contaminated by a pesticide. Which of the following bacteria would be your best choice to do this, and why? | Pseudomonas, because it is adaptable to growth on many different carbon sources |
| Myxobacteria are noted best for their . . . | ability to aggregate in response to quorum sensing |
| Which of the following has a unique cell cycle, in which only one of the two daughter cells is able to replicate directly? | Caulobacter |
| Instruments that are considered medically “critical” must be | sterilized |
| Place the following organisms in order from HARDEST to kill to EASIEST. (1) naked viruses (2) Pseudomonas cells (3) Bacillus endospores (4) Giardia cysts | HARDEST (3) > (4) > (1) > (2) EASIEST |
| Which of the following methods would be acceptable to sterilize a chicken thigh that is intended for long-term storage and eventual consumption (i.e. as part of a military ration)? | gamma ray irradiation |
| A mouthwash called “Hexodent” lists the following ingredients: 8% alcohol, 0.2% chlorhexidine, mint flavor. How does this mouthwash kill bacteria? | The chlorhexidine dissolves cell membranes. |
| Chlorox:20 minutes to decontaminate a water bottle from 104 Cryptosporidium cysts. Decimal reduction time for procedure is 10 minutes. Using the same method, how long would it take to decontaminate the water bottle if it had 108 Cryptosporidium cysts? | 60 minutes |
| What is the difference between high-level and low-level disinfectants? | High-level can kill Mycobacterium, low level often cannot |
| Rank the following treatments in terms of numbers of organisms that can survive the procedure: 1: autoclave 2: high temperature, short time (HTST) pasteurization 3: boiling 4: microwaving (not in water) | MOST SURVIVORS (4) > (2) > (3) > (1) LEAST SURVIVORS |
| Why are naked viruses more resistant to disinfection than enveloped viruses are? | Enveloped viruses require at least some water for the envelope to remain intact |
| How does UV light kill bacterial cells? | By mutating the DNA |
| Pasteurized milk . . . | can still have dozens of bacteria per ml |
| The decimal reduction time for disinfecting a Staphylococcus-contaminated steel countertop with 500 ppm chlorine bleach is 2 minutes. Which of the following would decrease the decimal reduction time? | using 5000 ppm chlorine bleach rather than 500 ppm |
| Iodine and its water-soluble derivative, betadine, are commonly used disinfectants. How do they kill cells? | Oxidize and denature proteins |
| Why is hydrogen peroxide (H2O2) considered high-level if used as a disinfectant, but only low level if used as an antiseptic? | Skin contains catalase, which can make H2O2 less effective. |
| Which of the following is the best method for sterilizing an implanted cardiac pacemaker? | Irradiate it with gamma (γ) rays |
| Which of the following medical instruments is NOT matched properly with an antimicrobial method that could be used to cleanse it? | Surgical sponge - Quaternary ammonium salt (QUAT) |
| Triclosan and Lysol both kill cells by damaging cell membranes. Bacterial resistance to Lysol is unknown, but triclosan resistance has become a major medical problem. Why the difference? | Triclosan acts against a single enzyme, mutations in which allow resistance |
| HTST pasteurization reduces bacterial contamination of milk by 5 logs in 15 seconds. What is the decimal reduction time for this procedure? | 3 seconds |
| A HEPA filter is used to filter the air in a hospital room. Filtered air is most likely to still contain . . . | Naked viruses |
| The most practical way to decontaminate a semi-critical medical device made of soft plastic is to . .. | soak it in 70% ethanol |
| Which of the following is the most likely to be decontaminated by exposure to ethylene oxide? | a pacemaker |
| You are cleaning a food preparation surface with a disinfectant. Which of the following is the hardest to kill, and why? | Naked viruses, because they have no sensitive external structures |
| Compared to a dry surface, an oily surface . . . | is likely to require a longer decimal reduction time for disinfection |
| Why can UV radiation be used to kill bacteria, but microwaves cannot? | Microwaves do not have enough energy to damage DNA |
| ____________ is a low-level antiseptic that damages bacterial membranes. It is often used in mouthwashes and skin care products | Chlorhexidine |
| ___________ are high-level disinfectants when used in the food industry, but only work at intermediate level when used medically on human skin | Peroxides |
| A patient has broken his leg. He needs to have a hollow metal pin and screws inserted to stabilize the fracture. How should the pin and screws be treated prior to the surgery? | by autoclaving them |
| Which of the following would be the most effective disinfectant against naked viruses? | Formaldehyde |
| Which of the following combinations of organism and antimicrobial method has the LONGEST decmial reduction time (D)? | naked viruses and Lysol |
| As applied in a medical setting, which of the following correctly describes a critical instrument? | It could be used after treatment in an ethylene oxide chamber. |
| By what mode of action do quaternary ammonium salts (QUATs) kill bacteria? | They are detergents that dissolve lipid membranes |
| It takes 25 minutes to pasteurize milk at 65 degrees C. You made pudding with a wooden spoon, and you want to decontaminate the spoon before you use it again. The decimal reduction time for dairy bacteria on the spoon in hot water would be about . . . | 5 minutes |
| Quaternary amines (QUATs) are low level disinfectants; aldehydes are high level. Why? | QUATs do not kill Mycobacteria; aldehydes do |
| HTST pasteurization takes 15 seconds, whereas killing 99% of bacteria at 63oC requires 12 minutes. How does the decimal reduction time compare at 72oC versus at 63oC? | D is between 10 and 100 times longer at 63o |
| A Lysol advertisement says that the product "is used in hospitals - Is the highest level disinfectant available. Kills 99.9% of germs on hard, nonporous surfaces in 30 seconds." Evaluate this claim. | It's a misstatement. 99.9% of germs in 30 seconds is actually a low level disinfectant. |
| A certain depth filter is designed to remove particles larger than 5 μm from air. How could you modify this filter to make it filter out bacteria? | Make it with smaller holes |
| Which of the following is a characteristic of ionizing radiation? | It kills cells by causing DNA mutations |
| How would you treat an implantable cardiac defibrillator before installing it in a patient? | Sterilize it with ethylene oxide |
| We said in class that 500 ppm bleach is used for typical disinfection. But in the food industry, the standard for washing dishes is 200 ppm to avoid chlorine in food. Which of the following statements is INCORRECT? | 200 ppm is actually better for decontaminating greasy dishes than 500 ppm |
| Why must the lagging strand at a replication fork be replicated in short fragments? | It is replicated toward the origin, but the fork is opening away from the origin |
| Which enzyme relieves the tension in DNA caused by unwinding the helix to replicate it? | DNA gyrase |
| Which of the following is needed to replicate DNA, but is NOT needed to make RNA from DNA? | a primer |
| How does a prokaryotic RNA polymerase recognize a promoter? | Its sigma subunit binds to consensus sequences at -10 and -35 |
| 5’---TAGTGTATTGACATGATAGAAGCACTCTTACTATAATCTCAATAGCTACG---3’ 3’---ATCACATAACTGTACTATCTTCGTGAGAATGATATTAGAGTTATCGATGC---5’ Which strand is the template, and in which direction is it read? | Bottom strand, read to the right. |
| DNA polymerase CANNOT do which of the following? | Synthesize the lagging strand continuously. |
| Which of the following is NOT a part of the updated (modern) “Central Dogma” of Biology? | Protein makes RNA |
| The enzyme DNA polymerase _____ | requires a short sequence of bases with a 3' OH to initiate its reaction |
| Which letter indicates an Okazaki fragment? | E |
| What is the role of DNA gyrase in DNA replication? | It uncoils DNA ahead of the replication fork |
| Which of the following is needed to make RNA, but not to make DNA? | A sigma factor |
| What provides the energy for the DNA polymerase reaction? | The reaction is coupled to pyrophosphate (P-P) hydrolysis by LeChatelier's principle |
| How does a bacterial cell know where to stop making RNA for a particular gene? | There is a hairpin loop in the DNA template |
| How does RNA polymerase determine which DNA strand to use as the template? | The template reads 3' to 5' in the direction the promoter is pointing |
| Why does a bacterial cell have multiple sigma factors? | This allows the cell to coordinately transcribe genes with related functions. |
| DNA polymerase needs all of the following EXCEPT _______ to replicate DNA | DNA polymerase needs all of the following EXCEPT _______ to replicate DNA |
| Replicated DNA in bacteria contains one error about every 5 million base pairs. Transcribed RNA contains about one error every 5,000 bases. What is the difference due to? | DNA polymerase has a proofreading ability; RNA polymerase does not. |
| What signals a bacterial cell to end transcription of a gene? | a hairpin loop |
| Which of the following is NOT true of the reaction carried out by DNA polymerase? | It needs a template and begins at a promoter. |
| Which of the strands in the replication fork at the right is the leading strand? | The bottom strand |
| Which of the following DNA replication enzymes is NOT correctly matched with its function? | Helicase – rewinds the DNA helix that the gyrase opens up |
| We mentioned that the DNA polymerase reaction uses NTPs (nucleoside triphosphates). Why is it that the enzyme cannot also use nucleoside diphosphates? | Pyrophosphate would not be produced from the polymerase reaction. |
| Some viruses have an RNA genome rather than DNA, and so they use RNA polymerase for replication. What conclusion can you make about such viruses? | Their replication has a very high mutation rate |
| Because double stranded DNA as we know it is composed of antiparallel strands _____. | Okazaki fragments are generated during DNA replication |
| Promoters of genes that are involved in the synthesis of the spore coat are indicated by arrows on the representation of a bacterial chromosome at right. How do you think a bacterium would most efficiently control spore coat biosynthesis? | by using a sporulation-specific alternate sigma factor |
| Which of the following is NOT a difference between DNA polymerase and RNA polymerase? | The direction in which the template is read |
| If the structure shown at right is introduced into a bacterium, what would happen? | Because a base cannot be added to it, it would stop replication |
| Which of the following is true about DNA polymerase? | It has the ability to correct this mistake below |
| Which of the following proteins is NOT correctly matched with a function? | Sigma factor – binds to the origin to initiate DNA replication |
| What determines whether a region of a bacterial genome will be transcribed? | Binding of a part of RNA polymerase to a DNA sequence |
| How many different sigma factors are there in a typical bacterial cell? | Several; one for each commonly encountered environmental condition |
| How does an amino acid recognize a specific codon? | an aminoacyl tRNA synthetase attaches a specific amino acid to a specific tRNA |
| We mentioned that one tRNA can recognize multiple codons by “wobble pairing.” For example, the tyrosine tRNA can recognize the codons UAU or UAC. In the diagram at the right, where could wobble pairing occur? (Hint: label all the 5’ and 3’ ends first.) | Position “1” |
| An insertion of one base into the coding region of a gene will do what? | Will change the entire protein downstream of the insertion |
| Eukaryotic mRNA cannot encode more than one gene because . . . | the ribosome must start at the first AUG after the 5’ end of the mRNA |
| What is the function of an aminoacyl-tRNA synthetase? | to attach an amino acid to a specific tRNA |
| Which of the following antibiotics does NOT affect protein synthesis? | Vancomycin |
| The diagram represents a moment during the translation process. What would be the NEXT thing to happen? | A peptide bond with Pro would transfer Met to the A site. |
| There are 61 coding codons, but only 45 tRNAs. How can 45 tRNAs recognize 61 codons? | The tRNA anticodons do not have to base-pair precisely with the codons. |
| We said that the antibiotic erythromycin "blocks the translocation reaction" to stop protein synthesis. What does "blocks the translocation reaction" mean? | prevents the ribosome from moving toward the 3' end of the mRNA |
| What happens at a Shine-Dalgarno sequence? | Prokaryotic ribosomes bind to mRNA |
| How is the reading frame determined to begin eukaryotic protein synthesis? | It starts at the first AUG from the 5' end of the mRNA |
| An mRNA codon is read by a tRNA. But what ensures that a tRNA is charged with the correct amino acid? | An aminoacyl-tRNA synthetase attaches a specific amino acid to a specific tRNA |
| The diagram at the right depicts the initiation step in translation. What is shown incorrectly? | The 'A' and 'E' sites are switched |
| It is believed that humans have only about 5 times as many different genes as the average bacterium, but we have 20 times as many different proteins. How is this possible? | Due to RNA splicing in humans, several proteins can be made from one gene |
| The MOST damaging mutation to a gene | Insertion of a C into the coding sequence of a gene |
| The LEAST damaging mutation to a gene | changing the codon UAA to UAC (please refer to the genetic code on page |
| How will the tRNA shown at the right get charged with an amino acid? (Please refer to the genetic code on page 1.) | An enzyme will attach Arg to the 3' end of the tRNA |
| The diagram represents a moment during the translation process. What would be the NEXT thing to happen? | The ribosome would translocate so CAA was in the A site |
| What is a "codon"? | a group of three mRNA nucleotides that represents an amino acid in a protein |
| The following sequence is a prokaryotic mRNA. The Shine-Dalgarno sequence is underlined. What would be the first three amino acids it encodes? 5' GAGCAUGCAACGGAGGCGGACAUGAAUUCAAGGCCAUGCAGGCCGUAGAUCGGAGCAA 3' | Met-Asn-Ser |
| Because wobble-pairing can occur during translation, . . . | there are fewer than 61 different types of tRNA |
| In protein synthesis, the transpeptidation reaction | Makes a peptide bond AND transfers the protein to the tRNA in the A-site |
| Which of the following mutations would be likely to cause the most damage to a cell? | Deletion of the promoter from the gene that encodes cysteine-tRNA synthetase |
| How will the tRNA shown at the right get charged with an amino acid? (Please refer to the genetic code.) | An enzyme will attach Cys to the 3' end of the tRNA |
| How can a single eukaryotic transcript be used to make more than one protein? | Different exons can be combined during splicing of the transcript |
| Which of the following is true about the translocation reaction during protein translation? | It moves a ribosome so that a tRNA is in the P-site |
| Which of the following is carried out by the spliceosome? | removal of introns from eukaryotic RNA |
| Which of the following changes to DNA is most likely to cause a change to the protein? | Deleting one base from a gene's coding region |
| The active site of an aminoacyl-tRNA synthetase recognizes . . . | An amino acid's R-group and a tRNA anticodon |
| The following is a snapshot of a moment during translation. Erythromycin blocks the translocation reaction during protein synthesis. What would be the sequence of the peptide produced by this ribosome if erythromycin was added right now? | Met-Arg-Asp |
| A prokaryotic mRNA is shown below. How will the codons in this sequence be read? (A significant sequence is underlined.) 5'-. . .GGCGAACAUGGAGGCTAGAUGCACCCUUCGCAGUACGU . . .-3' | AUG-CAC-CCU-UCG-CAG-UAC- . . . |
| Wobble pairing allows . . | the 5' base of the anticodon to recognize more than one 3' base of the codon |
| All of the following are consequences of coordinated transcription and translation EXCEPT | Prokaryotic genes are organized into operons |
| The antibiotic mupirosin inhibits the isoleucyl-tRNA synthetase. How does this kill a cell? | It makes a ribosome stop at isoleucine codons |
| A gene whose product catabolizes DDT as a carbon source is “induced” by DDT. What does this mean? | The gene is only transcribed in the presence of DDT |
| An inducer used with a positive regulatory system _____ | helps the activator protein bind to the DNA |
| Cells in a biofilm grow at a much higher cell density than planktonic cells. What is a result of such dense growth? | Genes that are induced by homoserine lactones (HSL) will be turned on |
| What is a “response regulator” in a two component regulatory system? | A protein that turns genes on or off in response to the environmental signal |
| The protein TrmB binds to the promoter region of the malE gene. The sugar trehalose binds to TrmB. In the presence of trehalose, the binding of TrmB to the malE gene is inhibited, and the malE gene is transcribed. TrmB is an example of _____ | a repressor |
| The protein TyrR can activate some genes and simultaneously repress others. This depends on _____ | whether TyrR binds upstream or downstream of the promoter |
| How does an inducer induce a gene without being present inside the cell? | By phosphate transfer between a membrane sensor kinase and a cytoplasmic regulatory protein |
| The mechanism whereby a cryptic gene is inserted downstream of an active promoter, as occurs in Neisseria gonorrhoeae, is called _____ | Cassette switching |
| What is an "operon"? | A region of DNA in which multiple genes are regulated by one promoter |
| Raffinose is the inducer of the rafB gene. Which of the following MUST be true about raffinose? | rafB mRNA is synthesized in its presence |
| Why is it an advantage for Neisseria gonorrhoeae to undergo cassette switching of its pilin genes? | New pilin proteins can be made without involving another regulatory event |
| What advantage does it give prokaryotes to have genes organized in operons? | Related genes can all be regulated by the same environmental signal |
| A gene with a -35 and -10 site whose nucleotide sequence closely matches the consensus sequence for an RNA polymerase sigma factor has no other regulatory protein binding sites nearby. This gene is _____ | probably constitutive |
| Gene regulation achieved by moving a gene from a silent (cryptic) site to an expressed site near a promoter is called _____ | cassette switching |
| Most of the genes in prokaryotes are regulated together in operons. Why is it that eukaryotes do not have their genes in operons? | Eukaryotic ribosomes can bind at only one place on each mRNA |
| An INDUCIBLE gene is _____ | transcribed only in response to an environmental signal |
| The zwf gene is constitutive. Which of the following is true? | The rate of zwf mRNA production is always the same |
| Which of the following is NOT true regarding cassette switching in bacteria? | It involves exchanging two genes and their promoters |
| Which of the following is true of activator proteins? | They are only used in positive control regulatory systems |
| We would probably classify the regulation of a gene for respiratory chain proteins in a facultative anaerobe as _____ | inducible |
| Which of the following best describes the function of a quoromone? | an indirect environmental inducer of certain genes |
| Which of the following is true of a prokaryotic operon containing two genes? | There will be a Shine-Dalgarno sequence at the 5' end of each gene |
| We said that transcription (trs) and translation (trl) are "coupled" in prokaryotes. Can they be coupled in eukaryotes? | No, because trs and trl occur in different cell compartments in eukaryotes |
| The cdx gene is under negative control. What does this mean? | Transcription of cdx mRNA can be blocked by a repressor protein |
| The lac operon is _____ | both inducible and repressible |
| Some bacteria can detect contact with a surface and use this contact signal to "know" when to begin transcribing genes for a glycocalyx that helps them adhere to the surface. How would this regulation most likely work? | Contact would distort a membrane protein, which would then transmit the signal to an activator protein |
| Which of the following is true of a gene that is under positive control? | It is expressed when a regulatory protein binds to the DNA |
| A repressible gene _____ | is turned off in response to an environmental signal |
| A gene that constitutively produces cAMP is cloned into E. coli. How would the lac operon be regulated in this transgenic bacterium? | It would only be induced by lactose |
| A quorum sensing gene in Staphylococcus aureus is controlled by a 2-component regulatory system. What does this mean? | A quoromone can induce the gene without crossing the cell membrane |
| If a gene is under negative control, ______ | its regulatory protein binds between -10 and +1 |
| Which of the following could best describe a two-component regulatory system? | A regulator is phosphorylated by a sensor that has received an environmental signal. |
| What is the purpose of cassette switching as a method of gene regulation? | To express gene variants that are otherwise silent |
| Which of the following is true of a three-gene operon under negative control? | It will be regulated by a protein that blocks transcription. |
| An inducible gene under positive control is transcribed ("turned on") ____ | when an inducer modifies a regulatory protein to allow the regulatory protein to bind |
| Which of the following is true regarding the lac operon? | It is induced by lactose and induced by cAMP |
| All of the following are needed for cassette switching EXCEPT _____. | Two different genes with the same promoter |
| The plasmid at the right is a cloning vector that contains an insert at the PvuII restriction sites as shown. You want to isolate the insert to clone it into a plant. What would be the easiest way to isolate the insert away from the rest of the vector? | Digest the plasmid with PvuII and separate the insert from the vector by electrophoresis |
| One way to make a specific mutation in a piece of DNA is to _____. | use a primer with a mismatched nucleotide |
| A DNA library is plated on a petri dish, transferred to a membrane, and washed with a fluorescent probe. This procedure is called “____________” | screening the library |
| You have cloned the green fluorescent protein (GFP) gene next to the promoter for the proP gene. For what purpose have you done this? | To use GFP as a reporter gene to report proP promoter activity |
| What is the correct order for the three steps in the polymerase chain reaction (PCR), starting with a double stranded DNA sequence? | denature the DNA, anneal primers, replicate the DNA |
| A piece of DNA 15 bases long that is tagged with a fluorescent label at the 3’ end could be used to _____ | locate a DNA sequence on a piece of filter paper |
| The lacZ gene, whose colored product is easily seen, is inserted without its promoter into the middle of the coding region of the ptsG gene. The lacZ gene in this experiment is being used as a _____. | reporter gene |
| Which of the following is NOT used when performing a Southern Blot? | Sequencing primer |
| It is now easy to make mutations in any bacterial gene we choose. What technique can we use to make designer mutations? | Probes with sequence mismatches used as replication primers |
| A 2008 Nobel Prize was awarded to the discoverers of the GFP reporter gene. What is a reporter gene? | A gene with a visible product used to report the activity of another gene's promoter |
| Which of the following is the easiest way to mutate a specific gene so that it is no longer transcribed? | Use a mismatched probe as a primer to mutate the promoter |
| A DNA library is plated on a petri dish, transferred to a membrane, and washed with a fluorescent probe. What is the purpose of this procedure? | to find which clone contains a particular gene |
| A probe can be used in all of the following procedures EXCEPT . . . | joining restriction-digested DNA fragments |
| Cells of the bacterium Bacillus anthracis that are pathogenic contain a plasmid whose size is about 6,000 base pairs. What is the best way to determine whether a particular B. anthracis cell is pathogenic? | Cell lysis followed by DNA gel electrophoresis |
| You want to investigate why there is an amino acid with a positively-charged R-group in the active site of enzyme X. To do this, you decide to mutate the amino acid to one with a negatively-charged R-group. How would you make such a mutation? | Use a probe with a sequence mismatch to replicate a clone of the gene for enzyme X |
| You read in a scientist's lab notebook that a probe for the sequence 5' GCGTAA 3' was made with the sequence 5' TTAGGC 3'. This was most likely _____. | a mistake. G does not pair with G, so the probe will not function |
| Which parts of the cloning procedure can be replaced with which steps in the PCR? (RE = restriction endonuclease; e'phoresis = electrophoresis; hyb. = hybridization) | e'phoresis and gene isolation replaced by denaturing, primer hyb. and replication |
| Which of the following sequences is considered a palindrome? | 5'-CGATCG-3' |
| Which of the following does NOT rely on the use of an oligonucleotide probe? | Examining gene transcription with a reporter gene |
| Algae are primarily classified based on _____ | the color of their photosynthetic pigments |
| Histoplasmosis is a systemic fungal disease spread by what means? | inhaling fungal spores in dust from bird droppings |
| The fungus in the picture at right belongs to what reproductive class? | Zygomycetes |
| A flea can pick up eggs of the dog tapeworm on its legs and transmit them to a human host. This is an example of a _______ | Mechanical vector |
| Which form of the pork tapeworm is especially dangerous, because it can migrate to the brain and form fatal abscesses? | Cysticercal larva |
| What type of organism is responsible for red tides? | a photosynthetic alga with red pigments |
| The LEAST serious human fungal infections _____ | are superficial |
| The typhus bacterium is transmitted from human to human via the body louse. The louse picks up the bacterium, usually from fecal matter, and lands on another human, who scratches it under his skin because it itches. The louse in this scenario is a _____ | mechanical vector |
| What makes the pork tapeworm especially dangerous compared to other tapeworms? | Its cystecerci can penetrate the bloodstream and cause brain abscesses. |
| Which microeukaryotes are classified based on their type of motility? | Protozoa |
| Fungal infections are particularly bad if the fungus is _____ | dimorphic |
| Of the following, the most serious nematode infection is _____ | Filarial worms living in the blood or lymph vessels |
| Which of the following is NOT part of the Schistosome life cycle? | Eggs are ingested by humans who eat contaminated food |
| If a bloom of the alga Pfiesteria were reported in a lake near where you lived, what would you expect to see in the news soon? | reports of many dead fish |
| If you were in Milwaukee in 1993 and got cryptosporidial diarrhea, you most likely swallowed what form of this apicomplexan protozoan? | Oocyst |
| Which of the following has been linked to carcinogenesis (cancer development)? | exposure to aflatoxin from the fungus Aspergillus |
| A common childhood infection, this relatively harmless intestinal worm can often be detected by dabbing clear tape around the anus and examining the tape for the adhering worms | Pinworm |
| The motile form of a protozoan is usually _____ | called a trophozoite |
| Algae are important to human health and disease because _____. | some algae produce toxins that can cause illness if humans come in contact with them |
| Which of the following is an example of a cutaneous fungal infection? | Ringworm (tinea corporis) |
| Why is it significant for a fungus to be “dimorphic”? | It is more likely to cause systemic human disease than other fungi |
| Which of the following is the best representation of the tapeworm infection cycle? | contaminated food → intestine → eggs in feces |
| How do some algae cause paralytic shellfish poisoning in humans? | They produce a neutotoxin that is ingested when people eat shellfish |
| An investigator with the city water department finds trophozoites of a sporozoan in a water sample. What can you deduce from this? | She could have identified them when she saw the apicomplexes |
| What sort of medical problem is caused by pinworms? | Intense itching around the anus as the worms crawl from the intestine |
| How do you typically get schistosomiasis? | by wading or standing in water that contains cercarial larvae |
| The picture at the right shows a _____ | ciliated protozoan |
| A food microbiologist looked at the loaf of bread shown here and decided to examine the contaminant microscopically. He observed the structure shown in the inset picture. How would he classify the organism that is contaminating the bread? | a zygomycete fungus |
| A patient from Mexico went to the hospital with seizures and loss of consciousness. A brain X-ray is shown at right. The X-ray technician circled some interesting lesions. What did the doctor conclude? | The patient had likely been consuming undercooked pork |
| A disease called Paralytic Shellfish Poisoning is caused by _____. | an algal toxin |
| Which of the following is a protozoan without any form of motility at all? | a Cryptosporidium cyst |
| Ringworm (tinea corporis) would most accurately be described as _____ | skin colonization by a cutaneous fungus |
| Amy's foot has developed the very itchy and inflamed skin lesion shown at right. How did Amy most likely acquire this infection? | Hookworm larvae penetrated the skin of her foot |
| What role does a snail play in the transmission of the disease Bilharzia? | The snail is the biological vector in which cercarial larvae develop |
| An organism with an apicomplex is called _____ | a sporozoan |
| Ringworm is a _____Ringworm is a _____ | cutaneous fungus |
| Your dog has fleas. Why might you not want to let it play with your kids? | Fleas can be a mechanical vector for tapeworm eggs |
| The person shown in the picture at the right is infected with _____ | Hookworm |
| Which stage of the schistosome life cycle causes liver damage? Which stage needs to enter a snail for further development? | eggs ; miracidia |
| Which of the following best describes a cutaneous mycosis? | It is itchy and annoying, but is not usually dangerous |
| Which of the following is an example of a biological vector? | A flea must take a blood meal to transmit an infection |
| A nematode that lives in blood vessels and is considered a serious health problem would most likely be a/an _____ | Filarial worm |
| Which of the following would NOT be used to classify a virus? | presence or absence of matrix protein |
| You get a “cold sore” on your lip. This is an example of a latent viral infection. A year later, you get another cold sore in the same place. How did this second infection arise? | The virus was “hiding” in your cells until it was reactivated. |
| How can a retroviral provirus cause cancer? | It can insert into and disrupt a tumor suppressor gene |
| Why is it notoriously difficult to develop a vaccine against segmented viruses? | They undergo genetic reassortment to produce new surface proteins |
| What is one way plant viruses differ from animal viruses? | Neither membrane fusion nor endocytosis can get them into a plant cell |
| How are prions infectious? | They act as “folding templates” to misfold other proteins |
| A virus cannot have within its capsid _____ | both DNA and RNA |
| A virus that enters a host cell by membrane fusion rather than by endocytosis _____. | must be an enveloped virus |
| A latent virus _____. | causes no cell damage |
| Place the steps in the replication of an acute virus in the correct order | membrane fusion, uncoating, DNA replication, assembly, budding |
| A chronic virus _____. | continually buds from the host cell for a long time period |
| How would you detect the presence of a provirus in a host cell? | Perform a Southern blot on the host's DNA and probe with a viral DNA probe |
| The Baltimore classification system for viruses is based on _____ | how the nucleic acid is replicated |
| Genetic reassortment is a way for _____. | segmented viruses to increase their variability |
| This plant is most likely infected with a . . . | mosaic virus |
| How can plant viruses spread through a plant? | They pass between cells through communication channels called plasmodesmata. |
| Viruses can be classified by all of the following EXCEPT _____. | shape of the lipid envelope |
| Varicella-Zoster virus (VZV) can be seen as a plasmid in infected cells from a person who does not show symptoms of virus infection. These infected cells do not contain any viral proteins. Which of the following is true? | VZV could reactivate and the person could show symptoms later |
| Which of the following is true for plant viruses? | The virus enters the cell through pre-existing holes, rather than by membrane fusion |
| Viruses in Baltimore Group V have negative stranded RNA genomes. Which of the following must be true? | They must carry a polymerase as a virus-associated enzyme. |
| How is the membrane assembled in an enveloped virus? | The membrane is simply the host cell membrane that surrounds the virus during budding |
| Can viruses that do not have a proviral form cause cancer? | Yes, if they carry a cell replication gene with a strong promoter |
| Given how they infect cells, plant viruses have somewhat different anatomy from animal viruses. Which of the following is true? | Plant viruses are almost always naked |
| What can enveloped viruses do that naked viruses cannot? | be released from host cells by budding |
| Viruses in the Herpes family are examples of latent viral infections. Which of the following would be true one year after a person is infected by a Herpesvirus? | Viral DNA could be detected in the person, even though viral capsomeres could not |
| Animal viruses, but not plant viruses, commonly do which of the following? | enter a host cell by membrane fusion |
| What is the difference between a virus in Baltimore group I and one in group II? | The mechanism used to replicate the nucleic acid |
| Which is the unique step in the life cycle of retroviruses? | Production of an RNA/DNA hybrid during replication |
| Epstein-Barr virus is responsible for many tumors, but it does not exist as a provirus. How can it cause tumor formation? | It can carry its own unregulated copy of an oncogene |
| What happens after prions cause protein misfolding? | Neuron death leads to brain tissue becoming porous |
| An antiviral agent inhibits the formation of a provirus. What would be a consequence of that? | The drug would reduce the likelihood of tumor formation by this virus |
| EBV is a type of virus that can cause a latent infection. Electron micrographs reveal small ring shaped molecules in the nuclei of infected host cells. Which of the following is true about a latent EBV infection? | The rings are non-replicating copies of the viral nucleic acid |
| Symptoms of a plant being infected with a virus include all of the following EXCEPT _____ | Holes form in leaves from lysis of epithelial cells |
| Which of the following would NOT be a good bacterial target for an antibiotic with a high therapeutic index? | Lipid synthesis |
| What is the mode of action of the antiviral medication acyclovir? | Nucleoside analog DNA/RNA synthesis inhibitor |
| Destroys cell membrane, therefore has low therapeutic index | Polymyxin |
| Protein synthesis inhibitor | Tetracycline |
| Prevents viral entry and uncoating | Amantadine (symmetrel) |
| A nucleoside analog that does not allow continued DNA or RNA synthesis | Acyclovir |
| Which of the following would you expect to be true when comparing a first generation antimicrobial drug with a second generation drug? | The second generation drug would have a higher therapeutic index |
| The first antibiotic to be used commercially is a competitive inhibitor of bacterial folic acid biosynthesis. What antibiotic is this? | Sulfanilamide |
| Why has the existence of R-plasmids made antibiotic overuse dangerous? | Using one antibiotic can select for growth of bacteria with multiple drug resistance |
| Which of the following would be a desirable property in an antimicrobial agent? | It is activated only in infected cells |
| Which of the following is NOT used as a target for antiviral agents? | protein synthesis |
| What is the mode of action of the fluoroquinolone antibiotics such as ciprofloxacin? | interfere with the action of DNA gyrase |
| One advantage of the Kirby-Bauer test compared to MIC testing is that the Kirby-Bauer test _____ | is cheaper and easier to perform in a clinical setting |
| Which of the following targets for antimicrobial drugs would be associated with the LOWEST therapeutic index? | Bacterial cell membrane |
| What is the mode of action of rifamycin? | inhibits bacterial RNA polymerase |
| Which of the following is a desirable property for a new antibiotic to have? | It should have a high therapeutic index |
| Usually antibacterial, antiviral and antifungal agents target different processes, but there is one process that can be targeted by all three agents. It is _____ | nucleic acid replication |
| A traveler to Brazil is given a prescription for Chloroquine. Why? | He may be exposed to malaria while in Brazil, and this will prevent an infection |
| Tamiflu (oseltamivir) works by _____ | preventing release of viruses from infected cells |
| Tetracycline is very commonly used in the US. It kills bacteria by _____ | preventing the attachment of tRNA to the A site of the ribosome |
| An E-test would be very useful when treating a Pseudomonas infection. Why? | R-plasmids and antibiotic resistance are very common in Pseudomonas |
| Which of the following properties might be expected in a second generation (GEN2) antibiotic, but not in a first generation one? | The GEN2 would be more acid resistant than the GEN1 |
| Acyclovir is commonly prescribed to treat Herpes virus infections. How does it work? | It is a nucleoside analog that inhibits viral replication |
| Which of the following is a commonly used, but highly toxic antifungal agent? | Amphotericin |
| Ivermectin is commonly used to treat _____ | helminth infections |
| When performing a Kirby-Bauer test on a particular bacterium, 8 antibiotic disks are placed on a lawn of the bacteria. It is found that there are no clear zones around any of the antibiotic disks. Which of the following is likely to be true? | The bacterium probably has an R-plasmid |
| Two antibiotics that prevent bacterial protein synthesis are _____. | Streptomycin and Tetracycline |
| Most antiviral drugs target _____. | viral nucleic acid synthesis |
| Which of the following genes would be LEAST likely to be found on an R-plasmid? | Genes encoding an ergosterol synthase |
| The basic mechanism that leads to the formation of an R-plasmid is _____. | Genetic Crossover (recombination) |
| Cephlex (cephalexin) is a very common prescription in the United States. What is its mode of action? | It inhibits bacterial cell wall cross-linking |
| Which of the following antimicrobial agents would most successfully reduce the symptoms if prescribed for a case of Herpes in a patient? | Acyclovir |
| Which of the following is prescribed to treat both anaerobic bacterial infections and infections caused by flagellated protozoans such as Giardia | Metronidazole |
| Before the antibiotic era, R-plasmids were _____. | present at low levels, but did not confer a selective advantage |
| The recently developed anti-MRSA drug mupirosin _____. | inhibits an aminoacyl-tRNA synthetase |
| A rancher notices that many of his sheep have acquired an intestinal worm infestation. Which of the following would he most likely use to treat the infected sheep? | Ivermectin |
| A cutaneous case of tinea corporis could best be treated with _____. | Fluconazole |
| One of the antifungal drugs that is the least toxic in humans interferes with fungal ergosterol biosynthesis. It is frequently taken orally | Fluconazole |
| Which of the following genes would you be surprised to find on an R-plasmid? | genes for a polyprotein protease |
| Which of the following antiviral agents would most successfully reduce the symptoms if prescribed for a case of Hepatitis C in a patient? | Telaprevir |
| Non-nucleoside polymerase inhibitors _____ | could allosterically inhibit an RNA-dependent RNA polymerase |
Created by:
Victoria Guadiano
Popular Biology sets