Save
Upgrade to remove ads
Busy. Please wait.
Log in with Clever
or
show password
Forgot Password?
Don't have an account?  Sign up 
Sign up using Clever
or
Username is available taken
show password


Make sure to remember your password. If you forget it there is no way for StudyStack to send you a reset link. You would need to create a new account. Your email address is only used to allow you to reset your password. See our Privacy Policy and Terms of Service.

Already a StudyStack user? Log In

Reset Password
Enter the associated with your account, and we'll email you a link to reset your password.
focusNode
Didn't know it?
click below
 
Knew it?
click below
Don't Know
Remaining cards (0)
Know
0:00
edit
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.

  Normal Size     Small Size show me how

Transcription/Transl

Transcription and Translation

QuestionAnswer
What does Transcription mean? To copy
What type of RNA is formed in the nucleus during transcription? mRNA
What enzyme adds nucleotides and unzips the DNA molecule to create mRNA? RNA polymerase
Can DNA leave the nucleus? NO
In what organelle does translation(protein synthesis) occur? Ribosome
What is the end product of Transcription and Translastion? Protein
What is the complementary strand of RNA for the following DNA strand: ATGATTAAGCGCATGCCCGATCA UACUAAUUCGCGUACGGGCUAGU
What type of RNA uses anticodons to transfer and translate amino acids? tRNA
What is the start codon? AUG
What are the termination codons? UAA, UAG, UGA
What is the amino acid for the codon AUG? (Use your codon chart) Methionine(START)
What is the amino acid for the codon UAC? (Use your codon chart) Tyrosine
What is the amino acid for the codon CAG? (Use your codon chart) Glutamine
Created by: jonathanlhall
Popular Biology sets

 

 



Voices

Use these flashcards to help memorize information. Look at the large card and try to recall what is on the other side. Then click the card to flip it. If you knew the answer, click the green Know box. Otherwise, click the red Don't know box.

When you've placed seven or more cards in the Don't know box, click "retry" to try those cards again.

If you've accidentally put the card in the wrong box, just click on the card to take it out of the box.

You can also use your keyboard to move the cards as follows:

If you are logged in to your account, this website will remember which cards you know and don't know so that they are in the same box the next time you log in.

When you need a break, try one of the other activities listed below the flashcards like Matching, Snowman, or Hungry Bug. Although it may feel like you're playing a game, your brain is still making more connections with the information to help you out.

To see how well you know the information, try the Quiz or Test activity.

Pass complete!
"Know" box contains:
Time elapsed:
Retries:
restart all cards