Busy. Please wait.
or

show password
Forgot Password?

Don't have an account?  Sign up 
or

Username is available taken
show password

why


Make sure to remember your password. If you forget it there is no way for StudyStack to send you a reset link. You would need to create a new account.
We do not share your email address with others. It is only used to allow you to reset your password. For details read our Privacy Policy and Terms of Service.


Already a StudyStack user? Log In

Reset Password
Enter the associated with your account, and we'll email you a link to reset your password.

Remove Ads
Don't know
Know
remaining cards
Save
0:01
To flip the current card, click it or press the Spacebar key.  To move the current card to one of the three colored boxes, click on the box.  You may also press the UP ARROW key to move the card to the "Know" box, the DOWN ARROW key to move the card to the "Don't know" box, or the RIGHT ARROW key to move the card to the Remaining box.  You may also click on the card displayed in any of the three boxes to bring that card back to the center.

Pass complete!

"Know" box contains:
Time elapsed:
Retries:
restart all cards




share
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.

  Normal Size     Small Size show me how

Final

Biology

QuestionAnswer
Describe Frederick Griffith's experiment and what his major findings were that contributed to the concept of DNA. He injected mice with R-strain & S-Strain (Harmful). The one with the R-strain livid & the one with the S-strain died. He heated up the S-strain turned into R-strain. Mixed the dea bacteria with R-Strain & mouse died. Discovered the transforming principle
What is transformation? Bacteria taking in DNA & transforming to another form.
Describe Alfred Hershey and Martha Chase's experiment and what his major findings were that contributed to the concept of DNA. Used radioactive sulfur when the injected to the bacteria it wasn't radioactive. Used radioactive phosphorous (virus has radioactive DNA) when injected into bacteria it was radioactive. They learned DNA holds the instructions and is the genetic material.
What contribution did James Watson and Francis Crick provide for the structure of DNA? Built 3D model of DNA
What does the message in DNA ultimately code for? Proteins
What is the basic building block of DNA? Nucleotides
What are the three main parts of a DNA nucleotide? Phosphate Group, 5 Carbon Sugar, Nitrogen Base
What are the four nitrogen bases in DNA? Adenine, Thymine, Guanine, Cytosine
What are the base pair rules? A --> T C --> G
Which two are pyrimidines? C & T
Which two are purines? A & G
What is DNA replication? The process of synthesizing a new strand of DNA. Exact copy of same DNA.
What does helicase do? Breaks up the hydrogen bonds that link the bases.
What does DNA polymerase do? Adds nucleotides to exposed bases, proofreads DNA.
What does ligase do? Bonds okazaki fragments together
What does primase do? Builds an RNA primer
What does semi-conservative mean with regards to DNA replication? Half of the original DNA strand is "conserved" or used in the new strand.
What is a primer? Why is it needed? It allows DNA polymerase to begin replication, Creates RNA Primer.
What is a leading strand? Built continuously
What is a lagging strand? Built in fragments
Explain the entire process of how a strand of DNA is replicated. Helicase splits the DNA (breaks the H bonds) DNA polymerase (p) does job on the leading & lagging strand. Primase builds RNA primer (P) the DNA p attaches to primer & builds chunks of DNA. The ligase connects the chunks & gets rid of P besides P on end.
What are the three differences between DNA and RNA? DNA is double stranded, uses Deoxyribose & has "Thymine". RNA is single stranded, uses ribose, & has "Uracil"
What is transcription? Writes DNA message into mRNA
What is the role of messenger RNA? Rewrites message as codons carries massage from nucleus to ribosomes.
What is an intron? Parts of DNA that doesn't hold information.
What is an exon? Parts of DNA that hold genetic information
How many genes are in a complete set of human DNA? 25,000
What is translation? Translates mRNAs message (codons) into proteins.
What do we call the three letter sequences in DNA and mRNA that get "read"? Codons
What do codons code for? Amino Acids
What is the start codon and which amino acid does it code for? AUG codes for met
What is a stop codon? UGA, UAA, UAG
What is the purpose of translation? To translate DNA to RNA so it can travel outside of the Nuclear Membrane & give info to ribosomes, so we can build protiens
What amino acid do all proteins start with? Met
Transcribe the following DNA sequence: TACATGTTCCTGGTATCGTA AUG UAC AAG GAC CCA UAG CAU
What is the new molecule (AUG UAC AAG GAC CCA UAG CAU) called that you just made? RNA molecule?
Translate the molecule (AUG UAC AAG GAC CCA UAG CAU) . Start Tyr Lys Asp Pro Stop
Explain the entire process of how we go from the DNA code to a functional protein. DNA is turned to mRNA in nucleus. mRNA travels to cytoplasm/ribosome (R). R read mRNA, translation occurs after the start codon, goes until stop codon & protein is released. R pull in RNA & puts the AA's in correct order, tRNA goes & picks up another AA.
What is a mutation? Change in DNA
What is a mutagen? Anything that causes a mutation.
What are some of the causes of mutations? Radiation, Smoking, Diet
If a mutation occurs in a somatic cell, will that mutation be passed on to your offspring? No
If a mutation occurs in a gamete, will that mutation be passed on to your offspring? Yes
What is a substitution mutation? Swapping one base for another
What is a deletion mutation? Remove a base, frameshift, dangerous, rare
What is a insertion mutation? Add a base, frameshift, dangerous, rare
Which mutations cause a frameshift? What is a frameshift? Deletion & insertion, It is where all the bases are shifted over to make new codons
What is a silent mutation? When mutation goes unnoticed, protein does not change.
What is a missense mutation? When a protein changes amino acid to another
What is a nonsense mutation? When the changed codon changes to a stop codon
Who is considered to be the "Father of Genetics"? Gregor Mendel
What is the difference between a character and a trait? A character is a category & a trait is a single object in the category (eye color vs blue eyes).
What is an allele? Different forms of a gene.
How many alleles for each gene does each parent pass on to their offspring? 1
What does dominant mean? Always expressed if there, strong gene
How do we represent a dominant allele? Capital letter
What does recessive mean? Weak gene
How do we represent a recessive allele? Lowercase letter
What does homologous mean? Same letters in the alleles, true breeding (GG x gg)
What does heterozygous mean? Different letters in the allele.
What is a genotype? Sequence of letters
What is a phenotype? Visible trait
Give an example of a homozygous dominant genotype. PP
Give an example of a homozygous recessive genotype. pp
Give an example of a heterozygous genotype. Pp
What is the law of dominance? Some alleles are dominant & some are recessive, dominant are expressed
What is the law of segregation? Only one allele is passed on, everyone has two alleles
What is the law of independent assortment? Genes for different traits that segregate independently do not influence each other inheritance, one gene has no effect on another
What is the principle of biological inheritance? Traits get passed on from parent to offspring
What is a Punnett Square used for? Calculates probability of inheritance.
Mendel's P generation were considered to be true breeders. What does this mean? Pea's will produce offspring identical to themselves & self pollination is required. Completely homozygous.
What were the genotypes and phenotypes of the parents in Mendel's P generation? Purple PP & White pp
What were the genotypes and phenotypes of the Mendel's F1 generation? All purple Pp
What did Mendel do with the F1 generation in order to create the F2 generation? He self breed them together, cross breed them
What were the genotypes and phenotypes of Mendel's F2 generation? Purple PP & Purple Pp & White pp
What was the phenotypic ratio of the F1 generation? 4:0
What was the phenotypic ration of the F2 generation? 3:1
What is a monohybrid cross? 1 trait
What is a dihybrid cross? 2 traits
Write the genotype of a dihybrid flower that is heterozygous for yellow seed color and homozygous recessive for shortness. Yyss
List all the possible allele options for: DD D
List all the possible allele options for: Rr R, r
List all the possible allele options for: RrTt RT, Rt, rT. rt
List all the possible allele options for: Gghh Gh, gh
What is incomplete dominance? Neither allele is dominant, blend
What is co-dominance? Neither allele is dominant or recessive, get both traits.
Make a punnett square for the following: A homozygous recessive white bunny and a heterozygous black bunny Bb x bb = Bb, Bb, bb, bb
Make a punnett square for the following: A purple flower with round seeds (PPRr) and a purple flower with wrinkled seeds (Pprr). PPRr x Pprr = PPRr, PPrr, PpRr, Pprr
Make a punnett square for the following: A heterozygous pink flower and a homozygous red flower (use incomplete dominance). RR x RW = RR, RR, RW, RW
A roan cow and a white cow (use codominance). RW, WW = RW, RW, WW, WW
What is a pedigree? A diagram showing genetic relationships between members of a family. It is used to analyze patterns of inheritance for specific genetic traits.
What is the difference between sex-linked and sex-influenced traits? Sex-linked is on one of the sex chromosomes. Sex-influenced is on an autosome but is affected by gender (but hormone levels).
Explain why sex-linked traits affect males more often than females. Sex-linked traits affect males more because males only need one gene to give them the trait.
What is a karyotype? an organized chart / map of chromosomes
How do we use a karyotype to determine chromosomal disorders? Look for extra or missing chromosomes / abnormalities
What is a trisomy? When there are three of one chromosome.
What disorders are trisomy disorders? Patau's Syndrome, Trisomy X, Down Syndrome, Edwards Syndrome, Klinefelter's Syndrome
What is a monosomy? Where there is only 1 chromosome not 2
What disorders are monosomy disorders? Turners Syndrome
What is a carrier? A woman is heterozygous for a trait so she can "carry" it & pass it to her children but does not have the condition herself.
What is a gene pool? All available alleles in the population
What is the difference between a multi allele trait and a polygenic trait? One gene that has more than two alleles (multi-allele). Multiple genes for one characteristic (polygenic trait).
Give an example of a multi-allele trait. Blood type
Give an example of a polygenic trait. Skin color, Eye color, Height, IQ
Know the following disorder: Turner Syndrome Girl has one X chromosome
Know the following disorder: Down Syndrome Extra 21st chromosome
Know the following disorder: Klinefelter's Syndrome Extra X chromosome, only in men
Know the following disorder: Trisomy X Three X chromosomes in women
What is nondisjunction? The failure of chromosomes or chromatids to separate normally caused by age.
What ways do we use to study human genetics? Pedigree, Twin Studies, Population Sampling
What are the limitations to studying human genetics? 1) Long lifespan 2) Non-random mating 3) Morals 4)Time between generations 5) Number of offspring
What is the Hardy-Weinberg equation? p^2 + 2pq + q^2 =1
What are the laws for Hardy-Weinberg? 1) Need a stable population 2) Large population 3) No mutations 4) No migrations 5) Random mating
What does Hardy-Weinberg measure? Allele frequencies
A population sample was taken of 3946 people and it was determined that only 63 people could taste the PTC chemical (recessive trait). What are the allele frequencies for this sample population?
How many of the sample population are homozygous dominant for the trait?
How many of the sample population are homozygous recessive for the trait?
How many of the sample population are heterozygous for the trait?
What are the different blood types? A++, A+-, A--, B++, B+-, B--. AB++, AB+-, AB--, O++, O+-, O--
What is the recessive blood type? O- blood
Is positive or negative blood recessive? Negative
What is the universal blood donor? O- Blood
What is the universal acceptor? AB+
What does applied genetics mean? Using genetic knowledge to choose traits passed on.
What are the two main goals of applied genetics? Enhance desired traits, & diminish undesired traits.
What is controlled breeding? Choosing what traits will be passed on, who will mate with who.
Know what inbreeding is. Parent with offspring, siblings, half siblings, preserves desired traits.
Know what line breeding is. Repeated individuals, makes sure enough time has passed so negative traits aren't passed on.
Know what outbreeding is. No relation, brings in new traits.
What is hybridization? The cross between two different individuals that are genetically different
What is hybrid vigor? Hybrids are genetically stronger
What is recombinant DNA? Combining DNA of two different organisms
What do we use to "cut" the DNA when producing recombinant DNA? Restriction enzymes
What is the difference between a sticky end and a blunt end? Show me an example of each. A sticky end (used in recombinant DNA) can be put back together & blunt end (used in gel electrophoresis) can't.
What enzyme is used to reattach the different pieces of DNA? Ligase
Explain the process of recombining DNA as we saw in our lab simulation. 1) Isolate gene 2) Restriction enzymes - cut DNA with a sticky end (use the same enzyme for all) 3) Ligase (Glues sections together) 4) Grow the bacteria with the plasmid 5) Test for uptake with antibiotics
What is a clone? A genetic copy of an organism
What was the first animal cloned? When did this occur? Frog in 1952
What was the first adult mammal cloned? When did this occur? Sheep in 1996
Explain the seven steps of cloning. 1) Remove egg 2) Remove DNA from egg 3) Remove Somatic cell from organism 4) Transfer DNA from Somatic cell to the empty egg 5) Activate egg 6) Implant back into sheep womb 7) Let grow
What is PCR and what is it used for? Polymerase chain reaction, to make more DNA from a small sample.
What is DNA fingerprinting? Using DNA to identify individuals.
What is gel electrophoresis used for? To separate DNA to match fragments to another piece of DNA (use pieces as a pattern)
Explain how gel electrophoresis works. Describe the steps involved in preparing the DNA and running the gel. 1) Cut DNA with restriction enzyme (blunt end) 2) Put DNA in wells 3) Run electric current.
List some uses for DNA fingerprinting. forensics, paternity testing, body identification
Explain the southern blotting technique. Why is this technique used? 1) Run Electrophoresis 2) Lay a nylon sheet over gel (positive charged) 3) DNA goes from double stranded to single stranded 4) Treated with radioactive nucleotides (probes) 5) Lay x-ray film or photographic paper (radiation exposes paper)
Explain what RFLPs are and why they are important for the DNA fingerprinting process. RFLP - Restriction Fragment Length Polymorphism. They are the different lengths of DNA fragments this is important so that we can match different pieces of DNA together.
What is the definition of evolution? Change over time
How old is the earth predicted to be? 4.6 billion years ago
The evidence suggests that life first began how long ago? 3.8 billion years ago
Explain the Miller-Urey experiment and what it tells us about the possibilities of how life began. They caused an enclosed system that represented the atmosphere & Sea. Electricity which represented lightning. Condensed represented rain. Amino Acids were in the water vapor. This gave us some type of idea how life was created.
What are the five main pieces of evidence we use to support evolution? 1) Biogeography 2) Embryology 3) Fossil Record 4) Comparative Anatomy 5) Molecular Biology
How do we use Biogeography to show how organisms are related? Look at where organisms are located & their adaptations in geographic distribution.
How do we use Embryology to show how organisms are related? Comparison of early stages of development among different organisms
How do we use Fossil Record to show how organisms are related? Shows past organisms & where they were alive / fossils are compared to see evolutionary change
How do we use Comparative Anatomy to show how organisms are related? Comparison of body structures in different species
How do we use Molecular Biology to show how organisms are related? Reveal evolutionary relationships comparing DNA & AA sequences between different organisms
Why is the fossil record an incomplete story? Only 1% of all organisms are fossilized
How many of the organisms that have ever lived have gone extinct? 99%
About how man of the extinct organisms have become fossilized? 1%
What are the types of fossils? 1) Petrified Fossil 2) Cast 3) Mold 4) Imprints
Describe a Cast. Mold fills with material, 3D model of the mold.
Describe a Mold. Deeper pattern in rock, Hard tissue
Describe a Imprint. Shallow pattern in rock, Soft tissue
Describe a Petrified Fossil Organic material is replaced with minerals
Explain why an individual organism cannot go through the process of evolution. You cannot change your DNA, genes have to be passed on
What does go through evolution? How does this occur? Population. The unfit for the environment die off and good traits are passed on.
What is a homologous structure? Give an example. Structures that are similar but have different functions. Human Arm V. Whale Arm.
What is an analogous structure? Give an example. Structures that have the same function but evolved evolved separately. Bat V. Bird.
What is a vestigial structure? Give an example. Remnants of features that served important functions in an organism's ancestors. In humans an Appendix, Tailbone, and Wisdom Teeth. In a Whale the Hip Bone.
What is speciation? Arise of new species from old species
On what island chain did Darwin make many of his major discoveries? Galapagos Islands
What did Lamarck believe about evolution? Lamarck believed that if you use something then use pass that trait on, but if you don't use that trait then you don't pass it on.
What mechanism did Darwin suggest as the driving factor of evolution? Natural selection
Describe how natural selection works. Populations evolve, amplify or diminish heritable traits. If the environment changes them the animal with the best traits live & the bad traits die. Some traits are better at surviving.
What must a population have in order to experience evolution or natural selection? Variation
What major factor causes species to have to evolve? Change in the environment
Why do species go extinct? They have no variation or cannot evolve at the same pace as the earth.
Explain evolution is a never ending process that never leads to perfection. Evolution is a change because of the environment. We will have to keep changing with the environment.
Why might an organism be the most "fit" today, but in five years, those same traits may be considered "unfit"? The environment changes & we might not have the trait needed anymore
What is microevolution? Small changes in the gene pool
What is allele frequency? How often a certain allele is in the gene pool
How does mutation affect the genes of a population? Introduces new genes to a population
How does Hardy-Weinberg tell if evolution is occurring? Hardy-Weinberg can show a change in the relative frequencies of alleles
What are the five main causes for genetic change? 1) Natural Selection 2) Genetic Drift 3) Gene Flow 4) Mutation 5) Sexual Selection (Non-Random Mating)
What is gene flow? Movement of individuals or gametes / spores between population & can alter allele frequencies in a population (migration).
What is genetic drift? How do the finches show this? Change in the gene pool of a population due to chance (random). Ex: earthquake. The finches show the founder effect.
What is the bottleneck effect? A loss of genetic diversity when a population is greatly reduced due to natural disasters.
What is the founder effect? When a few individuals colonize a new habitat. Start with limited genes in the population.
What characteristics must an organism exhibit in order to be considered "relative fit"? The ability to reproduce & survive in the environment, Produce the largest of viable, fertile offspring, Pass on the most genes to the next generations.
What is a species according to the biological species concept? A group of populations who live in the same place, interbreed in nature, and produce fertile offspring.
What is reproductive isolation? Prevents members of different species from mating with each other. Prevents flow between species & maintains separate species.
What is a prezygotic barrier? Prezygotic barriers prevent mating or fertilization between species
What are the five types of prezygotic barriers? 1) Habitat Isolation 2) Temporal Isolation 3) Behavioral Isolation 4) Mechanical Isolation 5) Gametic Isolation 6) Geographically Separated.
What is allopatric speciation? Population of the same species are geographically separated, Isolating their gene pools. Caused bulk of different organisms
What is sympatric speciation? Occurs when a new species arises within the same geographic areas as a parent species. Become unable to reproduce
What is adaptive radiation? How do the finches exhibit this? The evolution of many diverse species from a common ancestor. The finches are 14 different species but all came from 1 animal
What is gradualism? When does this type of speciation occur? Very slow constant change. When environment changes slowly
What is punctuated equilibrium? When does this type of speciation occur? Species change most as they arrive from an ancestral species & them experience relatively little changes for the rest of their existence. Rapid change then stay the same for a long, earth changes rapidly.
Explain whether natural selection / evolution is a planned process or a random process. Random you can't predict what the environment will look like.
What is a biome? The major types of ecological associations that occupy broad geographic regions of land or water
What two factors determine what the biome is? Climate & abiotic factors of the envioronment
What is a food web? A network of interconnecting food chains.
How is a food web different from a food chain? There are multiple paths (food chains)
What is a producer? An autotroph that supports all other trophic levels.
What is a primary consumer? A herbivore
What is a secondary consumer? Someone who eats herbivores
What are the characteristics of an r-selected species? Produce more offspring, grow rapidly in unpredictable environments
What are the characteristics of an k-selected species? Raise fewer offspring, maintain relatively stable populations.
What is the difference between exponential growth and logistic growth? Exponential growth is the rate of population increase under ideal conditions. Logistic growth is a description of the idealized population growth that is slowed by limiting factors as the population increases.
What must you have in order to keep growing exponentially? Unlimited resources
What is a carrying capacity? The capacity of the species that the earth can handle.
What does a population experience when it reaches carrying capacity? Why? The population will level off because they are compeating
What is succession? Results from colonization by a variety of species which are replaced by a succession of other species.
What is the difference between primary and secondary succession? Primary= Virtually lifeless, No soil Secondary= Disturbance destroys existing community but leaves soil intact.
What is a keystone species? A species whose impact on its communities is larger than its biomass or abundance
What happens to an ecosystem if a keystone species is removed? The community falls apart
What is an invasive species? Organisms that have been introduced into non-native habitats by human actions, rapid populations growth because they have no predators.
What are some invasive species in Michigan? Zebra Mussel
When an organism eats another organism, how much of the energy that the eaten organism gained during its lifetime is passed on to the organism that ate it? 10%
What is a niche? An organism's role in the community
What is a fundamental niche? Free from interference from other species
What is a realized niche? The part of fundamental niche that an organism occupies as a result of limiting factors present in its habitat.
What is coevolution? A series of reciprocal evolutionary adaptations in two species
What is the major factor that determines the stability or strength of an ecosystem? Biodiversity
What is the process called when bacteria or lightning take nitrogen from the atmosphere and recycle it back into the soil? Nitrogen Fixation
Humans have caused a lot of pollution and damage over the years, but which action has the largest effect on the ecosystems? Agricultural Fertilizers
What does density-dependent mean? Give some examples of density-dependant factors. Increasing population densities, density dependant rates result in declining births, & increase in deaths
What does density-independent mean? Give some examples of density-independent factors. Unrelated to population density. Examples are fires, storms, habitat destruction, seasonal changes in weather.
What are the signs of a healthy ecosystem? They supply freshwater & some foods, recycle nutrients, decompose wastes, regulate climate & air quality.
Created by: Elise.Postma