Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Destiny Bus Terms
Destiny Bus: Get a Clue
| Term | Definition |
|---|---|
| Codis | *Combined DNA Index System, a DNA database that stores information gained from crime labs in the U.S |
| RFLP | *Restriction Fragment Length Polymorphisms,any variation in DNA between indivisuals revealed by restriction enzymes that cut DNA into fragments of different lengths in consequence of such variations; used for forensics & heredity diseases |
| Sticky Ends | a fragment of DNA in which the nucleotides are stretched to an uneven length. They can form with a "complementary overhang." |
| DNA Fingerprinting | the analysis of DNA from samples of body tissues or fluids in order to identify an individuals. |
| Cleave | When a cell splits or departs, occurs in the telophase of an animal. |
| DNA | Deoxyribonucleic acid, A self replicating material present in nearly all living organisms; the carrier of genetic information |
| Comb | |
| Restriction Enzyme | any enzyme produced chiefly by certain bacteria, having the property of cleaving DNA molecules at or near specific sequence of bases. |
| Exclusion | The act of excluding a fetus or egg from the womb. |
| Hybridization | The act of mating two separate species to create a 2-in-1 organism, or a 'hybrid.' |
| VNTR | *Variable number of tandem repeats, where alleles of a chromosome are different for a number of repetition. |
| Nucleotides | basic structural unit of nucleic acids such as DNA. |
| Gel Lanes | a substance used on gel electrophoresis that can separate and analyze proteins and DNA |
| DNA Fragments | fragments of a living organisms DNA that can be used to piece together information about the individual, usually used during gel electrophoresis or forensics. |
| Palindrome | a segment of double stranded DNA in which the nucleotide sequence of one strand reads in reverse order to that of the complementary strand. |
| Wells | a 'well' in which the material goes into to be analyzed in a gel electrophoresis experiment. |
| STR | *Short Tandem Repeat, short sequences of DNA that are repeated a numerous amount of times in a head to tail manner. Ex: "gatgatgatgatgatgatgatgatgat" |
| Electric Field | a property of a patch of space which causes the acceleration of electric charges located at that patch of space |
| Inclusion | a foreign substance, either liquid or solid, usually of minute size enclosed in a mass of material. |
| Microliter | One millionth of a liter |
| Human Genome | Complete set of genetic information for humans. |
| Blunt Cut | End of a DNA fragment resulting from the breakage of a DNA molecule, yet both strands are the same length unlike sticky ends. |
| Buffer | |
| Recombinant DNA | DNA that has been formed artificially by combining constituents from different organisms |
| DNA Polymerase | The enzyme responsible for DNA replication. |
| Gene | A unit of heredity that is passed from a parent to an offspring |
| Digital Micropipet | A pipette that is designed for the measurement of very small volumes. |
| Staggered Cut | |
| Agarose Gel | A gel that is the main constituent of gel electrophoresis. |
| Inconclusive | Incomplete information |
| Fingerprint | An impression or mark made by somebody's finger that contains lines & ridges that individualize somebody. |
| Luminol | A versatile chemical that exhibits chemiluminescence & is most often usedin forensics |
| PCR | |
| Restriction Site | |
| Gel Electrophesis | |
| Evidence |
Created by:
kwolvington
Popular Biology sets