Save
Upgrade to remove ads
Busy. Please wait.
Log in with Clever
or
show password
Forgot Password?
Don't have an account?  Sign up 
Sign up using Clever
or
Username is available taken
show password


Make sure to remember your password. If you forget it there is no way for StudyStack to send you a reset link. You would need to create a new account. Your email address is only used to allow you to reset your password. See our Privacy Policy and Terms of Service.

Already a StudyStack user? Log In

Reset Password
Enter the associated with your account, and we'll email you a link to reset your password.
focusNode
Didn't know it?
click below
 
Knew it?
click below
Don't Know
Remaining cards (0)
Know
0:00
edit
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.

  Normal Size     Small Size show me how

Biology 1330 exam

Cellular and Mollecular Biology 1330 Final Exam

QuestionAnswer
•Transporter membrane proteins allow the movement of molecules across the membrane. –What are the three types of transport? •Which require energy? 3 types: 1. Passive (no ATP required) 2. Active (ATP required) 3. Co- Transport (ATP required indirectly by pumps)
•Chemical and electrical gradients affect molecule movement. –What is an electrical gradient? Electrical Gradient: Movement of molecules/ions due to charge
•Cotransport is also known as secondary active transport. –Where is energy used in secondary active transport? –What allows the cotransported molecule to move against its gradient? The co-transported molecule is moving against its concentration gradient. However, next to the channel is a pump, that is using ATP to generate active transport for another molecule through the cell membrane.This co-transported molecule then piggy backs
•The endomembrane system manufactures and ships proteins. •How do proteins get into the ER? •How are proteins sorted in the golgi? Proteins get put into the RER from the nucleus by vesicles, then it protein is synthesized, put into other vesicles and shipped to the golgi
•There are three main types of cytoskeletal elements. •What are the three types? •What protein are each made of? Microfilaments: Smallest. Made of Actin. Intermediate Filaments: Made of several things, one being Keratin. Microtubules: Largest and made of tubulin
•The extracellular layer of cells provides for shape, attachment and defense. •How is the extracellular layer different between plant and animal cells? Animal cells have a flexible phospholipid bilayer membrane surrounding the cell. Plants have this plus a hard cell wall made of cellulose and pectin.
•Cellular respiration is the breakdown of glucose for energy. •What is the general formula for cellular respiration? C6 H12 O6 + 6 O2 ----> 6 CO2 + 6 H2O + Energy
•Reduction can occur as the gain of hydrogen atoms. C6 H12 O6 + 6O2 -----> 6 CO2 + 6 H2O •What is reduced in the general formula for cellular respiration? The reduction of oxygen to water with the passage of electron to oxygen is the reduction reaction
•Cellular respiration occurs in four steps. •What are the four steps? 1. Glycolysis (outside of mitochondria) 2. Pyruvate Processing (oxidation of pyruvate to Acetyl CoA) 3. Krebs cycle/citric acid cycle 4. Electron transport chain, oxidative phosphorylation.
•The electron transport chain accepts the electrons from NADH and FADH2. •What is the path that the electrons take? •What is the result? e- pass from complex to complex, they power the movement of hydrogen atoms into the intermembrane space. The number of hydrogen atoms build up, powering production ofATP. In the case of the electron transport chain the momentum is used to make 32-38 ATP.
•Fermentation occurs when pyruvate accepts electrons from NADH. Is the aerobic or anaerobic? Fermentation is anaerobic
•Photosynthesis is two linked sets of reactions. •What are the two sets of reactions? Light reactions and the Calvin Cycle (dark reaction)
•Genome of the cell is packaged in chromosomes. •What is the difference between an unreplicated and a replicated chromosome? Unreplicated chromosomes are uncondensed a one long string. Replicated chromosomes become condensed and start to look like "X's" with sister chromatids
•Mitosis and cytokinesis occur in M phase. •What are the five parts of mitosis? PPMAT: Prophase, Prometaphase, Metaphase, Anaphas, Telophase.
•Chromosomes come in distinct types. •What are homologous chromosomes? Homologous chromosomes are chromosomes that contain the same genes, are the same length, but may have different alleles for those genes. In a homologous pair, one chromosome comes from the mother and the other from the father. They form the X
•Diploid organisms have chromosomes in pairs. •How do we identify homologs? In diploid (2n) organisms, the genome is composed of homologous chromosomes. One chromosome of each homologous pair comes from the mother and one comes from the father. Homologous chromosomes cross over in meiosis
•Why do we have two of each chromosome? One is from the mother and one is from the father. Genetic Variation.
•Homologs must pair in meiosis. •When do homologs pair? •When do they separate? Pair in meiosis 1 (Anaphase 1) Separate in meiosis 2 (Anaphase 2)
•Independent assortment produces genetic variation. •What does independent assortment refer to? Random assortment in chromosomes before they split into haploid daughter cells, allowing genetic variation to occur randomly
•Replication begins at origins of replication. •What is the difference between prokaryotes and eukaryotes at this point? Prokaryotes have circular DNA, replication fork begins at the origin, and replicates from there. Eukaryotes have a double helix strand, DNA forks begins at different places, and leading and lagging strands form
•DNA synthesis is continuous on the leading strand. •In what direction is the new DNA strand synthesized? •Does it change on the lagging strand? New DNA strand is being synthesized in the 5' to 3' going towards the fork. Lagging strand is going in the 5' to 3' direction AWAY from the fork.
•The ends of linear chromosomes pose a problem for the replication machinery. •How do cells replicate the ends of linear chromosomes? Telomeres are added to the end of linear chromosomes to maintain their integrity. Telomeres do not encode for proteins.
•Genes make gene products – proteins. •How does a genetic screen help us identify enzymes in a pathway? Helps us identify mutations ?
•The central dogma of molecular biology is: DNA ----> RNA ---> Protein
•How would you transcribe the following template strand of DNA? •3’ – TACCCATCTGTTCGCTGTACT – 5’ 3’ – TAC CCA TCT GTT CGC TGT ACT – 5’ 5' - ATG GGT AGA CAA GCG ACA TGA - 3'
•Transcription produces an mRNA copy of the DNA. •Which enzyme performs transcription?
Created by: Chani
Popular Biology sets

 

 



Voices

Use these flashcards to help memorize information. Look at the large card and try to recall what is on the other side. Then click the card to flip it. If you knew the answer, click the green Know box. Otherwise, click the red Don't know box.

When you've placed seven or more cards in the Don't know box, click "retry" to try those cards again.

If you've accidentally put the card in the wrong box, just click on the card to take it out of the box.

You can also use your keyboard to move the cards as follows:

If you are logged in to your account, this website will remember which cards you know and don't know so that they are in the same box the next time you log in.

When you need a break, try one of the other activities listed below the flashcards like Matching, Snowman, or Hungry Bug. Although it may feel like you're playing a game, your brain is still making more connections with the information to help you out.

To see how well you know the information, try the Quiz or Test activity.

Pass complete!
"Know" box contains:
Time elapsed:
Retries:
restart all cards