Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Cell Biology Final
final questions
| Question | Answer |
|---|---|
| 1. In 1665, _____________ used a microscope that he had built to examine thin slices of __________. While examining this material he observed tiny compartments that he called cellulae. | Robert Hooke, cork |
| 2. Which of the following is NOT a tenet of the cell theory? | All cells have a membrane bound nucleus |
| 3. which of the following is closest to a micrometer in size? | A typical bacterial cell |
| 4. Which of the following is true of a nanometer? | A nanometer is equivalent to 10 Angstoms |
| 5. The outcome of the joining of cytology and biochem yielded a better understanding of the cell by | Both A and B Identify cell structures and cell biochemical pathways |
| 6. Of the following cell stuctures which is the only one that can be seen using a microscope? | The mitochondria |
| 7. a scientist is examining mobile protozoa he wishes to determine their direction of movement. Which of the following microscopic techniques is least likely to be used to view these cells? | Electron microscopy |
| 8. Melvin Calvin and his colleagues used which of the following to deduce the steps in the Calvin cycle | Radioisotopes |
| 9. Which of the following statements is false | Organelles can be completely separated using differential centrifugation |
| 10. when scientitific method they use terms to indicate their degree of certainty. Which of the following terms conveys the least degree of certainty? | hypothesis |
| 11. Which of the following is true of an asymmetric carbon atom? | Asymmetric carbon atoms create stereoisomers |
| 12. Ribose have five carbon atoms of which three are asymmetric What is the maximum number of stereoisomers that may exist? | 8 |
| 13. While fishing a biology student makes the following observations a. Water spiders appear to be able to walk on the surface of water b. Flat rocks may be made to skip across the water. | Both C and D Water molecules are cohesive and often associated via hydrogen bonds |
| 14. Why do polar substances such as NaCl dissolve so readily in water? | Both C and D Spheres of hydration form between the water and ions and the charges ends of water mocecules are able to surround the oppositely charged salt ions. |
| 15. The cell membrane can be described most accurately as | Permeable to some molecules and impermeable to others. |
| 16. While synthesizing a new blue pigment a chemical notices that the new compound congregates between a aqueous environment and a hydrophobic environment When added to a mixture of oil and water the pigment creates a blue ring around the droplets of oil | The pigment is amphipathic having polar and nonpolar regions. |
| 17. Which of the following biological polymers is mismatched with its monomer? | Cellulose-Amino Acid |
| 18. The polymerization of different types of macromolecules is similar in many respects. Which of the following principles below is least likely to be common to all methods of polymerization of macromolecules? | Polymerization is passive requiring little ATP |
| 19. Which of the following sequences correctly lists the hierarchical nature of cellular structures from smallest to largest? | Organic molecules, macromolecules, supramolecular structures, organelles, cells |
| 20. An enzyme synthesized in the laboratory is found to have little activity when compared to the enzyme extracted from cell culture. Both enzymes were examined and have identical amino acid composition. | The synthesized enzyme was not folded correctly because molecular chaperones were not present |
| 21. The primary structure of a protein. | All of the above |
| 22. Small endogeneous RNA molecules that specifically down regulate expression by binding to the appropriate mRNA molecule and inhibit translation are | miRNAs |
| 23. Which of the following does not represent the correct paring of the three letter abbreviation with the amino acid? | Glu-Glutamine |
| 24. Disulfide bonds are often found to stabilize which of the following levels of protein structure? | Tertiary |
| 25. To which of the following classes of sugars does glucose belong? | Hexose |
| 26. The figure below shows the disaccharide ___________ which is made of _________ and __________. | Lactose, galactose, glucose |
| 27. Which of the following is NOT a structural polysaccharide? | Glycogen |
| 28. Which of the following is NOT a characteristic of DNA? | Contains ribose |
| 29. Which of the following is true of fatty acids? | Saturated fatty acids have no double bonds between carbons. |
| 30. Trans fats | All of the Above |
| 31. Fluorescence | Shows specific molecules |
| 32. Phase contrast | Exploits differences in thickness and refraction indexes of various regions of the cell |
| 33. Confocal | Uses a laser to view a single plane of a specimen |
| 34. Transmission electron microscopy | detects electrons passing through a specimen |
| 35. Scanning electron microscopy | detects electrons deflected from the surface of the specimen |
| 36. Molecular chaperon | assists in protein assembly |
| 37. Important in hydrogen bonding | hydroxyl group |
| 38. Structural polysaccharide | cellulose |
| 39. Informational macromolecule | nucleic acid |
| 40. Membrane structure | lipid bilayer |
| 41. Nucleotide | AMP |
| 42. Nucleoside | Adenosine |
| 43. Purine | guanine |
| 44. Pyrimidine | cytosine |
| 45. A globular protein | Ribonuclease |
| 1. The surface area/ volume ratio for a cell ________. | Can become a limiting factor to cell size because the surface is required for exchanges with the environment |
| 2. Cells of the liver and kidneys need to detoxify harmful molecules that enter the bloodstream and have an abundant number of ______________. | Peroxisomes |
| 3. A person suffering from severe muscle weakness would be likely to have a defeat in which organelle? | Mitochondria |
| 1. Which of the following organelles is not generally found in animal cells? | Central vacuole |
| 5. Prokaryotes have __________ S ribosomes with ________S and ___________S subunits whereas eukaryotes have _____________S ribosomes with ______________S and ___________S subunits? | 70,50,30; 80, 60, 40 |
| 6. The major structural elements of the cytoskeleton are | Microtubules, microfilaments, and intermediate filaments |
| 7. Which of the following diseases is caused by a peroxisomal defect? | Neonatal adrenoleukodystrophy (NALD) |
| 8. Which sequence reflects the locations that a secretory protein will visit on its way from its production to its secretion outside the cell? | Rough ER, ER vesicle, Golgi complex, secretory vesicle |
| 9. Which of the following organelles is not part of the endomembrane system? | Ribosomes |
| 10. Kuru is a degenerative disease of the central nervous system believed to be caused by which type of agent? | Prion |
| 11. Plasmodesmata in plant cells are most similar in function to animal cell____________ | Gap Junctions |
| 12. _________ are infectious RNA molecules | Viroids |
| 13. Consider the reaction A + B → C + D + energy | All of the above are correct |
| 14. Identify the activation energy on the following energy diagram. | d |
| 15. Which of the following properties is not characteristic of enzymes? | Alter the equilibrium distribution of substrate and product |
| 16. Succinylcholine is structurally similar to acetylcholine If succinylcholine combines with the enzyme that normally hydrolyzes acetylcholine the enzyme is no longer able to hydrolyze acetylcholine. This suggests that ____________. | Succinylcholine must be a competitive inhibitor with acetylcholine |
| 17. Which statement is NOT true about the effects of various conditions on the activity of an enzyme? | An enzymes activity is generally reduced by an increase in substrate concentration |
| 18. Enzyme regulation may occur by several methods. Which of the following is not a means of enzyme regulation? | Saturation |
| 19. Inactive precursor enzymes must undergo __________ to be activated | Irreversible proteolytic cleavage |
| 20. According to the EC system which is not one of the major groups of enzymes? | Proteases |
| 21. In negative feedback mechanisms when excess metabolic end products fill allosteric enzyme sites ___________. | The metabolic reaction is halted |
| 22. The Michaelis constant | Is equal to the substrate concentration at Vmax/2 |
| 23. The induced fit model | Involves a conformational change in the shape of the enzyme |
| 24. A linear relationship between V and substrate concentration would be expected when | Both choices B and C [S]<<Km [S] = Km |
| 25. Which of the following is not a function of membranes? | Information storage |
| 26. Which of the following molecules would not readily cross an intact cell membrane by simple diffusion? | Glucose |
| 27. Based on your knowledge of the chemistry of the cell membrane which of the following compounds would you couple with a new drug in order to achieve better uptake by cells? | Lipids |
| 28. Based on the composition of cell membranes the most prominent lipids are | Phospholipids |
| 29. Of the following lipids which is found in approximately equal amounts in both the outer and inner portions of the lipid bilayer. | Cholesterol |
| 30. Inactivation of a fluorescent dye in a very concentrated spot of a cell so that the fluidity of membranes can be visualized is called | Photobleaching |
| 31. The ability of some organisms to compensate for temperature changes by altering the lipid composition of membrane lipids is known as | 31. The ability of some organisms to compensate for temperature changes by altering the lipid composition of membrane lipids is known as |
| 32. A prokaryote organism is isolated froma hydrothermal vent, where it has been observed to be thriving. Based on your knowledge of the plasma membrane, you would expect to find a predominance of | Largely saturated fatty acids |
| 33. Ankyrin is aperipheral membrane protein found in erythrocytes. Therefore __________. | It lacks discrete hydrophobic sequences |
| 34. Which of the following classes of integral membrane proteins is NOT a transmembrane protein? | Integral monotopic |
| 35. Which of the following is sterol-like lipid associated with the cell membrane of prokaryotes? | Hopanoids |
| 36. Thin layer chromatography (TLC) separates lipids based on | Hydrophobicity |
| 37. Endocytosis and exocytosis allow exchange of materials between membrane – bound vesicles and the exterior of the cell. | T |
| 38. All proteins of the cell are synthesized in the rough ER | F |
| 39. Microtubules are polymers of G-actin | F |
| 40. Enzymes involved in the synthesis or degregation of polymers often exhibit group specificity. | T |
| 41. A nonprotein component of an enzyme that is usually a metal ion or small organic molecule is called a prosthetic group | T |
| 42. The higher the Km value for a given substrate the more effective the enzyme is with that substrate | F |
| 43. Nonprotein catalysts are known as zymogens | F |
| 44. The presence of trans fats in membranes decreases the transition temperature and increases membrane fluidity. | F |
| 45. Most unsaturated fatty acids are in the cis configuration but some are in the trans configuration making their shape more like that of saturated fatty acids. | T |
| 46. Nucleolus | Ribosome production |
| 47. Extracellular matrix | Support and flexibility |
| 48. Cytoskeleton | Cell shape and movement of organelles |
| 49. Central vacuole | turgor pressure |
| 50. Ribosome | a. Protein synthesis |
| 1. The technique that allows various proteins to be differentiated based on size once the proteins have been denatured is | sds-PAGE |
| 2. With respect to the outer and inner faces of the lipid bilayer of the cell membrane the composition of proteins is | Asymmetrical |
| 3. Membrane proteins can _____________. | All of the above |
| 4. You discover an integral membrane protein that has terminal sialic acid groups attached to amino acid residue via N- and O- links It therefor most likely ___________. | A Glycoprotein |
| 5. Most lipid anchored proteins are attached to the otter side of a plasma membrane by ___________. | Covalent linkage to gylcosphosphatidylinositol (GPI) |
| 6. Many integral membrane proteins have not been analyzed by x-ray crystallography. However transmembrane segments can be inferred using computer analysis of the amino acid sequence of the proteins. This technique is known as. | Hydropathic analysis |
| 7. A patient needs an emergency transfusion. The blood type is unknown. What type of blood should be given to the patient? | O |
| 8. A colleague gives you two membrane fractions from a plant cell lysate. One contains the plasma membrane fraction, the other the mitochondrial fraction. | Carbohydrates |
| 9. Proteins of the membrane are | All of the above |
| 10. Which of the following best describes the special high energy bond of ATP? | Phosphoanhydride |
| 11. Three hypothetical phosphorylated compounds (A,B, and C) are involved in energy metabolism. Standard free energies of hydrolysis for A = -12.7 kcal/mol, B= -3.3 kcal/mol, and C = -6.5 kcal/mol. | a,c,b |
| 12. Reduction in biological systems is usually accompanied by | hydrogenation |
| 13. Oxygen is absolutely required by | Strict aerobes |
| 14. The gross output of ATP from glycolysis is __________ whereas the net output of ATP is _____________. | 4; 2 |
| 15. Which of the following statements best describes the role of NAD+/NADH in glycolysis? | NAD+ is used to carry elections |
| 16. Which of the following is not a fate of pyruvate within a cell? | All of he above |
| 17. Glucose is transported in the bloodstream to cells in all parts of your body. In cells, glucose has four main fates. Which of the following is not one of those fates? | Glucose is transformed into sucrose |
| 18. Which of the following statements is NOT true of glycolysis? | It oxidizes glucose to carbon dioxide |
| 19. During strenuous exercise, you may notice that your muscles burn. Which of the following statements best explains this phenomenon? | Without oxygen, pyruvate is being converted to lactic acid |
| 20. Which of the following is not a product of fermentation | Sucrose |
| 21. The purpose of the fermentation process is the | Regeneration of NAD+ |
| 22. The process of glucose synthesis is called. | Gluconeogenesis |
| 23. Much of the suitability of ATP as an energy intermediary is related to the instability of the bonds between the phosphate groups. These bonds are unstable because ______________. | a. The negatively charged phosphate groups vigorously repel one another |
| 24. The glycolytic enzymes that are allosterically regulated ____________. | Are enzymes that catalyze reactions with large negative delta G’s |
| 25. Substrate – level phosphorylation ___________. | Occurs when a phosphate is transferred to an ADP from a specific phosphorylated substrate |
| 26. All of the following are directly used as alternative substrates for glycolysis except | Ribose |
| 27. During ATP synthesis protons move down their electrochemical gradient through | The Fo complex of ATP synthase |
| 28. Because NADH generated in the cytosol cannot enter the mitochondrion, electrons and protons from the NADH in kidney cells are transferred into the mitochondrion by | Malate-aspartate electron shuttle |
| 29. As pyruvate is completely oxidized in the TCA cycle, some of its energy is _______________. | Conserved in NADH and FADH2 |
| 30. The products from only the TCA cycle from one pyruvate are | 2 Carbon Dioxide, 1 ATP, 3 NADH, and 1 FADH2 |
| 31. In prokaryotes, aerobic respiration generates _________ ATP molecules. | 38 |
| 32. Which of the following would not be used as a final electron acceptor in anaerobic respiration? | Oxygen |
| 33. In electron transport, which respiratory complex is not involved in the flow of electrons from FADH2? | Complex I |
| 34. The sequential process of fatty acid catabolism to acetyl CoA is called | B-oxidation |
| 35. In comparing B-oxidation to glycolysis, it can be said that _____________. | B-oxidation produces more energy per carbon because all carbons go through the TCA cycle, while only two-thirds of carbons from glucose do. |
| 36. Obligated anaerobe describes an organism that can function in an aerobic or anaerobic environment. | F |
| 37. Oxidation is defined as the removal of electrons. In biological systems, these are usually accompanied by protons in a process called dehydrogenation. | T |
| 38. Resonance stabilization describes a condition in which extra electrons are delocalized over all possible bonds | T |
| 39. The process by which animals synthesize glucose and other carbohydrates from 3- and 4- carbon precursors is known as | T |
| 40. The sequential process of fatty acid catabolism to acetyl CoA is called B-oxidation. | T |
| 41. ATP synthesis that involves phosphorylation events linked to oxygen-dependent electron transport is called substrate-level phosphorylation | F |
| 42. In eukaryotes, pyruvate is converted to acetyl CoA in the inner membrane of the mitochondria | F |
| 43. Glycolysis also called the glycolytic pathway, is a 10-step reaction sequence that converts glucose into Acetyl Co | F |
| 44. As pyruvate is prepared for the TCA cycle, it undergoes a process of oxidative phosphorylation | F |
| 45. Protruding from the inner membrane of the mitochondria into the matrix are knoblike spheres called F1 complexes, which are attached by a short protein stalk to an Fo complex. Together these complexes are referred to as the Fo/F1 complex. | T |
| 1. IP3 receptors are associated with | ER membranes |
| 2. Kinases are enzymes that | Add phosphate group |
| 3. MAPKs are activated by | Mitogens |
| 4. Which of the following pairings is not correct | Adenylyl cyclase – ATP |
| 5. With regard to hormones responses occurring over the shortest distance would be classified as | Autocrine |
| 6. Which of the following statements regarding the RAS protein is false | RAS is a trimeric G protein |
| 7. G protein – adenyl cyclase activity has been shown in some cases to be associated with certain disease In the case of cholera which of the following is not correct. | The cholera toxin causes the cells of the gut to take in salts and fluids |
| 8. Paracrine hormones | Act locally |
| 9. Cyclic AMP is ________________. | An allosteric regulator of Protein Kinase A |
| 10. Which of the following statements is are true of the alpha subunit of a G protein? | All of the above |
| 11. The receptor for epidermal growth factor (EGF) is a typical receptor tyrosine kinase Therefore it does not | Have seven transmembrane domain |
| 12. Which of the following represents a Molecular switch that activates Galpha proteins | Exchanges GDP for GTP on Galpha |
| 13. Calcium ions that act as second messengers are stored in ____________. | Endoplasmic reticulum |
| 14. When a chemical messenger reaches a target cell it binds to a receptor A hydrophobic ligand binds to a ____________. Whereas a hydrophilic ligand binds to a _____________. | Intracellular receptor, transmembrane receptor |
| 15. A protein kinase activating many other protein kinases is a example of ___________________. | Amplification |
| 16. Base sequence variation between individuals that result from point mutations are called | Single nucleotide polymorphisms |
| 17. In 1928 Fredrick Griffith experiments with Streptococcus pneumonia suggests that | Heat-killed bacteria could somehow transform live bacteria |
| 18. In experiment designed as those of Hershey and Chase 35S was added to a virus replication within its bacterial host. The new virions were carefully isolated and used to infect fresh bacterial cells in the absence of any radioisotopes. | In the phage ghosts |
| 19. Which of the following are components of Chargaffs rules of bases? | All of the above |
| 20. An example of a purine is? | Guanine |
| 21. A recently isolated bacterial strain has been given to you for general characterization of the genome. You begin by isolating the DNA and subjecting it to thermal denaturation. You use E. Coli DNA as a reference (A+T=G+C) | G-C content with respect to E. Coli |
| 22. When examining a five-carbon sugar to determine if it is ribose or deoxyribose one looks to see if there are two H on the ____________ carbon in the structure | 2’ |
| 23. The 5’ end of a DNA molecule can be chemically distinguished from the 3’ end because there is a _________ group at the 5’ end and a __________ group at the 3’ end. | PO4, OH |
| 24. DNA isolated from cow liver cells contains 36% A what percent will be C? | 14% |
| 25. A husband and wife are in the process of getting a divorce. During child support hearing the husband states that he should not pay child support because he feels he is not the father. | The husband is definitely not the childs father. |
| 26. Which of the following statements regarding the Watson and Crick model of DNA is not accurate? | It is left handed |
| 27. DNA isolation from Apergillis has an adenine content of 25 percent what is the G + C percentage | 50% |
| 28. Restriction enzymes typically | Specific palindromic sequences |
| 29. Using the sanger method of DNA sequencing results in the figure below are obtained following gel electrophoresis of the DNA fragments | 5’ ACCCTTGCAAGACGTTTGCCA 3’ |
| 30. The normal gene for hemoglobin was isolated, clones and subjected to restriction enzyme disgestion with BAMHI . Following the gel, three bands are routinely obtained. However, following the same procedure with the hemoglobin gene from an | The mutation associated with sickle-cell results in the gain of a BAMHI cut site |
| 31. The alpha subunit of a heterotrimeric G protein is active when bound to GDP. | False |
| 32. A ligand is a second messenger | False |
| 33. A number of cancers result from loss of regulation of growth factor signaling | True |
| 34. Hormones acting over long distances are paracrine | False |
| 35. Most calmodulin-binding proteins are enzymes such as protein kinases and phosphatases | True |
| 36. The name given to double stranded DNA that is twisted upon itself is undercoiled | False |
| 37. The name given to the areas of study that is involved with the determination of the entire DNA sequence of an organism is known as proteomics | False |
| 38. In the integrated or lysogenic stage the DNA of the temperate phage is prophage | True |
| 39. Common SNP may be important in causing disease in humans or in treatment of disorders | True |
| 40. Tm of a double stranded DNA molecule increases with increasing % of A=T | False |
| 41. Phospholipase C | Catalyzes formation of second messenger diacylglycerol (DAG) |
| 42. Precursor of diacylglycerol | IP3 |
| 43. Monomeric G protein | RAS |
| 44. Adenylate cyclase | Catalyzes formation of cAMP from ATP |
| 45. Necessary for the activation of heterotrimeric G protein | GTP |
Created by:
las028
Popular Biology sets