DNA and RNA
Quiz yourself by thinking what should be in
each of the black spaces below before clicking
on it to display the answer.
Help!
|
|
||||
|---|---|---|---|---|---|
| show | small organic molecules made up of a pentose sugar (ribose or deoxyribose) a phosphate group& 1 nitrogenous base (adenine, guanine, cytosine, thymine or uracil). used as the "building blocks" of nucleic acids (DNA and RNA).used to form high energy comps
🗑
|
||||
| Okazaki fragments | show 🗑
|
||||
| show | specific types of covalent bonds that form between the sugar of 1nucleotide& phosphate group of the next nucleotide in a nucleic acid chain. are strong bonds involving the sharing of electrons
🗑
|
||||
| Sigma factor | show 🗑
|
||||
| show | enzymes catalyzes the attachment of amino acid molecules to specific t-RNA molecules to form Aminoacyl-t-RNA molecules (also called ‘charged’ t-RNA)
🗑
|
||||
| The nucleic acids, DNA and RNA, are long chain molecules made up of smaller units called _______________________________ that are connected together by phosphodiester bonds. | show 🗑
|
||||
| In RNA these smaller units contain a sugar called ______________________________ while in DNA they do not. | show 🗑
|
||||
| are long chain molecules made up of small repeating units called nucleotides. The 5' end of each nucleotide is bound to the 3' end of the next via a covalent bond known as a _______________________________ bond. | show 🗑
|
||||
| show | deoxyribose/ thymine
🗑
|
||||
| Cellular DNA molecules (and some viral RNA molecules) are double stranded, i.e., the purine bases in one strand are complimentary to specific ___________________________ bases in the other and are bound to them by _______________ bonds. | show 🗑
|
||||
| show | purines/ complimentary pyrimidine
🗑
|
||||
| The two strands of a DNA double helix are oriented in opposite directions 5’ to 3’, or are “upside- down” relative to one another, and so are said to be ______________________________. | show 🗑
|
||||
| is made up of a pentose sugar, a nitrogenous base, and a phosphate group. If a polymer is formed by connecting a series of these small molecules together, what chemical group would be located at the 5’ end? __________________________ | show 🗑
|
||||
| process by which DNA molecules reproduce themselves is sometimes called semiconservative __ because each new duplex formed contains half of the original DNA. This process is initiated@ sites on an existing DNA strand called__. | show 🗑
|
||||
| DNA replication- These include DNA& RNA ___, enzymes that can catalyze the attachment of nucleotides to the free 3' end of existing nucleotide strands; and __ an enzyme that serves2 bind the fragments of the lagging strand into a single long chain). | show 🗑
|
||||
| Prokaryotic microorganisms reproduce their chromosomal and plasmid DNA by a process called _____________________________________. | show 🗑
|
||||
| Since polymerase enzymes can only “build” DNA in the 5’ to 3’ direction, 1strand is formed in a continuous sequence,& the other is formed in a series of segments called | show 🗑
|
||||
| show | 3’/
🗑
|
||||
| show | RNA polymerase (sometimes called primase)/ DNA ligase
🗑
|
||||
| show | transcription/ nucleoside triphosphates or activated nucleotides (ATP, GTP, CTP, etc.) When these contain the sugar ribose they may be designated as rNTPs.
🗑
|
||||
| Transcription is the process by which ___ are made, and is similar to semi- conservative replication in that: 1.) it requires a single strand of DNA to serve as a template. 2.) ____ 3.) ____ | show 🗑
|
||||
| The region on a DNA strand where transcription begins is called the _______________________ site and is recognized by a protein called _____________________________ (which is a portion of the RNA polymerase enzyme complex). | show 🗑
|
||||
| show | energy
🗑
|
||||
| That portion of DNA dependent RNA polymerase which determines where transcription will begin and in which direction it will proceed is called ________________________________. | show 🗑
|
||||
| show | messenger-RNA (m-RNA), transfer-RNA (t-RNA) or ribosomal-RNA (r-RNA)
🗑
|
||||
| eukaryotic cells most genes are split genes, so transcription is followed by a process called ___ during which RNA molecules are modified by having their _ removed and by having a cap and a poly-A tail added. This process is accomplished in part by s-R | show 🗑
|
||||
| show | spliceosomes/
🗑
|
||||
| show | exons
🗑
|
||||
| RNA molecules that coordinate the attachment of t-RNA to m-RNA during protein synthesis are called ________________________ while RNA molecules called ________________________ carry individual amino acids to the ribosomes for protein synthesis. | show 🗑
|
||||
| show | messenger-RNA (m-RNA)/ polycistronic
🗑
|
||||
| show | aminoacyl-t-RNA-synthetases
🗑
|
||||
| That portion of the t-RNA which determines which amino acid is added to the polypeptide next is called the _________________________ region and forms hydrogen bonds with m-RNA at the ribosome. | show 🗑
|
||||
| show | messenger-RNA (m-RNA)/
🗑
|
||||
| The factor that insures each t-RNA is carrying the correct amino acid is _________________________________________. | show 🗑
|
||||
| show | anticodon
🗑
|
||||
| The enzymes which insure that each t-RNA is carrying the correct amino acid are called ___________________________. | show 🗑
|
||||
| show | codon
🗑
|
||||
| show | translation/ ribosomes
🗑
|
||||
| show | anticodon/ Messenger-RNA (m-RNA) molecules
🗑
|
||||
| show | peptidyl transferase
🗑
|
||||
| show | anticodon/ codon
🗑
|
||||
| show | termination of the amino acid chain. These are stop or terminator codons.
🗑
|
||||
| show | a. the m-RNA base sequence = AGAUGUCAAACCCGUAUGGAAUGGUUG
c. the amino acid sequence = arginine, cysteine, glutamine, threonine, arginine, methionine, glutamic acid, tryptophan, leucine
🗑
|
||||
| show | In this case, yes, because there are no stop or terminator codons. The AUG at the middle of the sequence would code for methionine, but is not recognized as a start codon in this example because it is not at the beginning.
🗑
|
||||
| Explain briefly how the nucleotide sequence of a structural gene can have a significant influence on metabolism (i.e., how genetic information influences cell activity). | show 🗑
|
||||
| show | peptide
🗑
|
||||
| show | ribosome/ stop or terminator codon
🗑
|
||||
| show | polyribosome or polysome
🗑
|
||||
| single m-RNA molecule is normally attached to several ribosomes during the translation process, forming a unit referred to as a ________________________________. | show 🗑
|
||||
| The ribosomes provide an enzyme called ____________________________________ which catalyzes the formation of peptide bonds between the individual amino acids thus forming a polypeptide chain. | show 🗑
|
Review the information in the table. When you are ready to quiz yourself you can hide individual columns or the entire table. Then you can click on the empty cells to reveal the answer. Try to recall what will be displayed before clicking the empty cell.
To hide a column, click on the column name.
To hide the entire table, click on the "Hide All" button.
You may also shuffle the rows of the table by clicking on the "Shuffle" button.
Or sort by any of the columns using the down arrow next to any column heading.
If you know all the data on any row, you can temporarily remove it by tapping the trash can to the right of the row.
To hide a column, click on the column name.
To hide the entire table, click on the "Hide All" button.
You may also shuffle the rows of the table by clicking on the "Shuffle" button.
Or sort by any of the columns using the down arrow next to any column heading.
If you know all the data on any row, you can temporarily remove it by tapping the trash can to the right of the row.
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Created by:
tarabain