| Question | Answer |
| Nucleotide | small organic molecules made up of a pentose sugar (ribose or deoxyribose) a phosphate group& 1 nitrogenous base (adenine, guanine, cytosine, thymine or uracil). used as the "building blocks" of nucleic acids (DNA and RNA).used to form high energy comps |
| Okazaki fragments | small segments of DNA that form on the lagging strand during DNA replication. |
| Phosphodiester bonds | specific types of covalent bonds that form between the sugar of 1nucleotide& phosphate group of the next nucleotide in a nucleic acid chain. are strong bonds involving the sharing of electrons |
| Sigma factor | protein that binds with the core enzyme of the RNA polymerase complex found in prokaryotic cells. Sigma factors recognize sections of DNA known as promoter sites and are required to initiate transcription (RNA synthesis). |
| Aminoacyl-t-RNA-synthetase | enzymes catalyzes the attachment of amino acid molecules to specific t-RNA molecules to form Aminoacyl-t-RNA molecules (also called ‘charged’ t-RNA) |
| The nucleic acids, DNA and RNA, are long chain molecules made up of smaller units called
_______________________________ that are connected together by phosphodiester bonds. | nucleotides |
| In
RNA these smaller units contain a sugar called ______________________________ while in
DNA they do not. | ribose |
| are long chain molecules made up of small repeating
units called nucleotides. The 5' end of each nucleotide is bound to the 3' end of the next via a
covalent bond known as a _______________________________ bond. | Nucleic acids/ phosphodiester |
| Cellular DNA molecules differ from cellular RNA molecules in that they are double stranded
rather than single, are much larger (longer), contain the pentose sugar
_______________________ and the pyrimidine base __________________________. | deoxyribose/ thymine |
| Cellular DNA molecules (and some viral RNA molecules) are double stranded, i.e., the purine
bases in one strand are complimentary to specific ___________________________ bases in the
other and are bound to them by _______________ bonds. | pyrimadine/ hydrogen |
| In the DNA double helix (duplex), the nitrogenous bases Adenine and Guanine (bases with two
rings in their structure) are called _________________________. These will form hydrogen
bonds with their _________ bases Thymine and Cytosine,
respectively. | purines/ complimentary pyrimidine |
| The two strands of a DNA double helix are oriented in opposite directions 5’ to 3’, or are “upside-
down” relative to one another, and so are said to be ______________________________. | antiparallel |
| is made up of a pentose sugar, a nitrogenous base, and a
phosphate group. If a polymer is formed by connecting a series of these small molecules
together, what chemical group would be located at the 5’ end? __________________________ | nucleotide/ a phosphate group |
| process by which DNA molecules reproduce themselves is sometimes called semiconservative
__ because each new duplex formed contains half of the original DNA. This process is initiated@ sites on an existing DNA strand called__. | replication/origin of replication |
| DNA replication- These include DNA&
RNA ___, enzymes that can catalyze the attachment of
nucleotides to the free 3' end of existing nucleotide strands; and
__ an enzyme that serves2 bind the fragments of the lagging
strand into a single long chain). | polymerases (DNA-dependent DNA and RNA polymerase) / DNA ligase |
| Prokaryotic microorganisms reproduce their chromosomal and plasmid DNA by a process
called _____________________________________. | replication (semiconservative replication)/ |
| Since polymerase enzymes can
only “build” DNA in the 5’ to 3’ direction, 1strand is formed in a continuous sequence,&
the other is formed in a series of segments called | Okazaki fragments |
| The polymerase enzymes involved in building DNA can only “build” in one direction because
they can only add nucleotides (bases) to the _________ end of a growing nucleotide strand. | 3’/ |
| In E. coli, the enzyme required to start
each Okazaki fragment is DNA dependent _________________________________. The
Okazaki fragments are eventually spliced together by ______ enzymes,
and the DNA duplex is completed | RNA polymerase (sometimes called primase)/ DNA ligase |
| The process by which cellular RNA molecules are formed is called RNA synthesis or
_____________________________ and is similar to replication in that it requires a single
strand of DNA as a template (pattern) and energy as provided by _________. | transcription/ nucleoside triphosphates or activated nucleotides (ATP, GTP, CTP, etc.) When these contain the sugar ribose they may be designated as rNTPs. |
| Transcription is the process by which ___ are made, and is
similar to semi- conservative replication in that:
1.) it requires a single strand of DNA to serve as a template.
2.) ____
3.) ____ | all RNA molecules/ 2.) it involves polymerase enzymes (in this case, DNA-dependent RNA polymerase)/ 3.) it requires energy in the form of nucleoside triphosphates (rNTPs) or activated nucleotides. |
| The region on a DNA strand where transcription begins is called the
_______________________ site and is recognized by a protein called
_____________________________ (which is a portion of the RNA polymerase enzyme
complex). | promoter/ sigma factor |
| Transcription also requires _____________________ which is provided by the
nucleotides (rNTPs) involved in the process. | energy |
| That portion of DNA dependent RNA polymerase which determines where transcription will
begin and in which direction it will proceed is called ________________________________. | sigma factor |
| Once this protein binds to the promoter site of the DNA molecule, the core enzyme can bind,
and transcription can proceed. Each ____ molecule formed via this process is
essentially a copy of one small segment of one strand of the DNA. | messenger-RNA (m-RNA), transfer-RNA (t-RNA) or ribosomal-RNA (r-RNA) |
| eukaryotic cells most genes are split genes, so transcription is followed by a process called
___ during which RNA molecules are
modified by having their _ removed and by having a cap and a
poly-A tail added. This process is accomplished in part by s-R | post-transcriptional modification/ introns |
| Eukaryotic cells produce small or short RNA molecules (s-RNA) that bind to proteins to form
structures called _______________________________. | spliceosomes/ |
| These are involved in posttranscriptional
modification& recognize where RNA molecules are to be cut&
spliced. After regions are removed, segments of RNA called
___ are spliced together and the resulting molecule is given a cap and a
poly-A tail. | exons |
| RNA molecules that coordinate the attachment of t-RNA to m-RNA during protein synthesis are
called ________________________ while RNA molecules called
________________________ carry individual amino acids to the ribosomes for protein
synthesis. | ribosomal-RNA (r-RNA)/ transfer-RNA (t-RNA) |
| RNA molecules known as __are actually copies of small
segments of DNA known as structural genes. In prokaryotic cells, these RNA molecules often
contain info that allows them to code for more than 1polypeptide chain (protein)
because transcription is _ | messenger-RNA (m-RNA)/ polycistronic |
| Individual t-RNA molecules carry specific amino acids to the ribosome during the synthesis of
proteins. The enzymes catalyzing reactions attaching specific amino acids to t-RNA are called____________________________________. | aminoacyl-t-RNA-synthetases |
| That portion of the t-RNA which
determines which amino acid is added to the polypeptide next is called the
_________________________ region and forms hydrogen bonds with m-RNA at the ribosome. | anticodon |
| The sequence of codons on a ______________________ molecule determines the sequence of
amino acids in a polypeptide, but the amino acids cannot recognize nor bind to these molecules.
Instead, each amino acid is carried by a specific t-RNA molecule. | messenger-RNA (m-RNA)/ |
| The factor that insures each
t-RNA is carrying the correct amino acid is _________________________________________. | the enzyme (aminoacyl-t-RNA synthetase) that catalyzed the bond between the amino acid and the t-RNA. |
| The primary factor determining which t-RNA will bind to the A-site of the ribosome at any
given moment is whether or not the ______________________________ region of that t-RNA
can form hydrogen bonds with the complimentary bases of m-RNA. | anticodon |
| The enzymes which insure
that each t-RNA is carrying the correct amino acid are called ___________________________. | aminoacyl-t-RNA synthetases. |
| A _____________ may be defined as a set of three bases on m-RNA which codes for a specific
amino acid. This same term can also be applied to a set of three bases on a DNA strand. | codon |
| The process by which proteins are made is called protein synthesis or _____________________
and occurs in association with structures called ___________________________ in both
prokaryotic and eukaryotic cells. | translation/ ribosomes |
| During the translation process, the _________________________ regions of a t-RNA
molecules form hydrogen bonds with the codons of __________________________________
as they pass through the ribosome. | anticodon/ Messenger-RNA (m-RNA) molecules |
| The enzyme which catalyzes the formation of a peptide
bond between two adjacent amino acids is called _____________________________________
and is part of the ribosome itself. | peptidyl transferase |
| The primary factor determining which t-RNA will bind to the A-site of the ribosome at any
given moment is whether or not the _______________________ region of that t-RNA can form
hydrogen bonds with the _____ (set of three complimentary bases) of m-RNA. | anticodon/ codon |
| Three sets of nucleotides (nitrogenous bases) known as "ocher", "amber" and "umber" do not
code for individual amino acids, but instead code for
_____________________. | termination of the amino acid chain. These are stop or terminator codons. |
| If the sense strand of DNA has the base sequence
TCTACAGTTTGGGCATACCTTACCAAC
Transcrip of this DNA will yield__
Translation of the RNA represented above will yield ___ | a. the m-RNA base sequence = AGAUGUCAAACCCGUAUGGAAUGGUUG
c. the amino acid sequence = arginine, cysteine, glutamine, threonine, arginine, methionine, glutamic acid, tryptophan, leucine |
| Does the polypeptide represented above contain the same number of amino acids as there are
codons in the m-RNA formed? ___________ Explain why or why not. | In this case, yes, because there are no stop or terminator codons. The AUG at the middle of the sequence would code for methionine, but is not recognized as a start codon in this example because it is not at the beginning. |
| Explain briefly how the nucleotide sequence of a structural gene can have a significant influence
on metabolism (i.e., how genetic information influences cell activity). | The nucleotide sequence of a structural gene determines the codon sequence of a specific m-RNA molecule, which in turn determines the amino acid sequence (primary structure) of a specific polypeptide. This determines the activity the protein will have. |
| Each amino acid being added to a growing polypeptide chain is bonded to the previous amino
acid by a covalent bond called a _______________________ bond. | peptide |
| This bonding is catalyzed
by an enzyme called peptidyl transferase which is part of the ________________________.
The termination of a growing polypeptide chain is signaled by the presence of a
________________________________ on the m-RNA molecule. | ribosome/ stop or terminator codon |
| The term _____________________________ may be used to describe a unit formed by many
ribosomes attached to and translating a single m-RNA molecule. | polyribosome or polysome |
| single m-RNA molecule is normally attached to several ribosomes during the translation
process, forming a unit referred to as a ________________________________. | polyribosome or polysome |
| The ribosomes
provide an enzyme called ____________________________________ which catalyzes the
formation of peptide bonds between the individual amino acids thus forming a polypeptide
chain. | peptidyl transferase |