Help
Options
Didn't know it?
click below
click below
Knew it?
click below
click below
Don't Know
Remaining cards (0)
Know
retry
shuffle
restart
0:00
Embed Code - If you would like this activity on your web page, copy the script below and paste it into your web page.
Normal Size Small Size show me how
Normal Size Small Size show me how
Protein Synthesis
Protein Synthesis & Mutations
| Changes in the genetic material of a cell are called _____ | mutations |
| The type of RNA that carries an amino acid to the ribosome. | tRNA |
| _________ is a molecule that carries the genetic instructions used in the growth, development, functioning and reproduction of all known living organisms and many viruses | DNA |
| The genetic code consists of three-letter 'words' called ______ formed from a sequence of three nucleotides | codons |
| The full set of relationships between codons and amino acids (or stop signals) is called the ________ | genetic code |
| The following RNA sequence contains a very short yeast protein: AUGUGUCCCACUAUCCCUAUC Use a codon chart to decode the message...what will be the sequence of amino acids in the protein? | met | cyst |pro | threo | iso | pro | iso |
| How does RNA differ from DNA? | 1. The sugar in RNA is ribose instead of deoxyribose 2. RNA is usually single stranded (number of strands) 3. RNA contains uracil in place of thymine. (the nitrogenous bases) |
| The RNA molecule that carries copies of instructions for the assembly of amino acids into proteins from DNA to rest of cell is called _____ | mRNA |
| The type of RNA that transfers amino acids to ribosomes during protein synthesis | tRNA |
| The instructions for making proteins is contained in the ______ | DNA |
| The type of RNA that conveys genetic information from DNA to the ribosomes | mRNA |
| What are the building blocks of proteins? | amino acids |
| The transfer of genetic information from DNA to RNA is called _____ | transcription |
| The process by which the sequence of bases of an mRNA is converted into the sequence of amino acids of a protein is called | translation |
| A point mutation when a base is replaced with any other base is called _____ | substitution |
| Where in the cell do mRNA and amino acids on tRNA come together? | at the ribosomes |
| The conversion of genetic information from the language of nucleic acids to the language of proteins is called ________ | translation |
| What molecules are produced in translation? | proteins |
| What amino acid sequence would the DNA sequence TAAAGT code for? | Ile | Ser |
| List two ways that mutations could affect the organism, | 1. Code for wrong amino acid 2. STOP early |
| Where in the cell will the mRNA go once it has been constructed? | Ribosome |
| In the ribosome, the mRNA is divided into groups of 3 bases called _____ | codons |
| The top of protein synthesis that occurs in the ribosome is called _____ | translation |
| At the ribosome, the mRNA will meet with what molecule? | tRNA |
| If the codon is "AAC", the amino acid will be ________ | Asparagine |
| Joining amino acids together builds a ________ | protein |
| A gene is a specific set of _______ | DNA |
| Each gene codes for a ________ | protein |
| Proteins are made of ___________ | amino acids |
| Protein synthesis is such an important topic to learn because ______ | It is the process that builds your traits |
| The process when RNA is made using the DNA template strand is called _____ | Transcription |
| Why must DNA be transcribed into mRNA | The DNA code can't leave the nucleus |
| The process when mRNA is read a protein is made is called _______ | Translation |
| What is the purpose of a tRNA? | Carry one amino acid to the ribosome during translation |
| What is the purpose of mRNA? | Carry DNA's code from the nucleus to the ribosome |
| Where does transcription take place? | In the nucleus |
| Where does translation take place | In the ribosome |
| How does the ribosome know to stop adding on amino acids to the protein? | A STOP codon is made |
| What really gives the instructions on what order to put the amino acids in? | DNA code |
| Transcribe the template DNA: TACGGACTAAAA | AUGCCUGAUUUU |
| Translate the following sequence to a protein AUGCCUGAUUUU | Meth | Pro | Asp | Phenyl |
| How many different codons are there for Glycine? | 4 codons |
| How many different codons are there for Arginine? | 6 codons |
| Why is gene regulation important? | It controls the amount of protein made by a gene |
| All the genes that belong to an organism are found in each cell no matter what type of cell it is. How does this relate to gene expression? | Only specific genes are shown based on the cells function |
| How many amino acids would be in a protein translated from the following strand of mRNA? mRNA - AUGCCGAACGCACUUCAU | 6 amino acids |
| How many amino acids would be in a protein translated from the following strand of mRNA? mRNA - AUGUCGGGCUUUACUGACUAC | 7 amino acids |
| Using the template DNA given, show the protein that would be translated TTCCCGGAAACT | Lys | Gly | Leu | STOP |
| Using the template DNA given, show the protein that would be translated AAGGGCTTCTCAGTA | Phenyl | Pro | Lys | Ser | Hist |
| Proteins are manufactured (made) by the ________ | ribosomes |
| What nitrogen base is found in RNA, but not DNA? | uracil (U) |
| What nitrogen base is found in DNA, but not RNA? | thymine (T) |
| The main function of proteins is _________ | to build new body tissue |
| __________ are the instruction manuals for our bodies | genes |
| Genes are made of ___________ | DNA |
| ______________ is when the product of a gene, or a specific protein is being produced by a cell. | Gene expression (or protein synthesis) |
| ______is copying of genetic information from DNA to RNA | Transcription |
| _______ is decoding of mRNA into a protein | Translation |
| __________ goes through the pores of the nucleus with the DNA code and attaches to the ribosome | mRNA |
| _____________ carries amino acids from the cytoplasm to the ribosome | tRNA |
| Amino acids are joined together to make a _____________ | protein |
| Use a codon chart to find the amino acid sequence for the following mRNA strand: CACCCAUGGUGA | Histidine | Proline | Tryptophan | Stop |
| Use a codon chart to find the amino acid sequence for the following mRNA strand: AUGAACGACUAA | Methionine | Aspargine |Aspartic Acid | Stop |
| ______________ is a mutation in which one nucleotide is exchanged for another | substitution |
| _________ is a mutation in which one or more extra nucleotides is added to DNA | insertion |
| ________ is a mutation in which one nucleotide is taken out. | deletion |
| For the template DNA, provide the resulting amino acid: TCTTCA | Arginine | Serine |
| For the template DNA, provide the resulting amino acid: TATAAA | Isoleucine | |Phenylalanine |
| For the template DNA, provide the resulting amino acid: CGAGTG | Alanine | Histidine |
| For the following mRNA sequence (codon), provide the resulting amino acid sequence: AGAAGU | Arginine | Serine |
| For the following mRNA sequence (codon), provide the resulting amino acid sequence: AUAUUU | Isoleucine | |Phenylalanine |
| For the following mRNA sequence (codon), provide the resulting amino acid sequence: GCUCAC | Alanine | Histidine |
| For the template DNA, provide the resulting mRNA TCTTCA | AGAAGU |
| For the template DNA, provide the resulting mRNA TATAAA | AUAUUU |
| For the template DNA, provide the resulting mRNA CGAGTG | GCUCAC |
| One codon of mRNA reads GUA, which specifies valine. If a mutation changes the first nucleotide of the DNA coding for this RNA to an A, use the genetic code to determine what amino acid will be put in after the mutation. | mRNA = GUA --->DNA = CAT mutation DNA = AAT, corresponding mRNA = UUA UUA = Leucine |
| Explain the steps of protein syntheses (beginning with DNA in the nucleus unzipping) | DNA --> mRNA --> tRNA + amino acid --> protein (trait) |
Created by:
Jbev